ID: 975024469

View in Genome Browser
Species Human (GRCh38)
Location 4:69531640-69531662
Sequence GACAGCTCATGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975024466_975024469 11 Left 975024466 4:69531606-69531628 CCATCTTCTGCAGATAACTACTC 0: 178
1: 192
2: 102
3: 110
4: 247
Right 975024469 4:69531640-69531662 GACAGCTCATGGCCTGTTACTGG No data
975024465_975024469 15 Left 975024465 4:69531602-69531624 CCTGCCATCTTCTGCAGATAACT 0: 185
1: 187
2: 104
3: 111
4: 225
Right 975024469 4:69531640-69531662 GACAGCTCATGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975024469 Original CRISPR GACAGCTCATGGCCTGTTAC TGG Intergenic
No off target data available for this crispr