ID: 975025585

View in Genome Browser
Species Human (GRCh38)
Location 4:69544293-69544315
Sequence TGGCTGTTACAGCTGCTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975025584_975025585 -8 Left 975025584 4:69544278-69544300 CCATCAAGGCTGATCTGGCTGTT No data
Right 975025585 4:69544293-69544315 TGGCTGTTACAGCTGCTACATGG No data
975025583_975025585 -7 Left 975025583 4:69544277-69544299 CCCATCAAGGCTGATCTGGCTGT No data
Right 975025585 4:69544293-69544315 TGGCTGTTACAGCTGCTACATGG No data
975025582_975025585 -6 Left 975025582 4:69544276-69544298 CCCCATCAAGGCTGATCTGGCTG No data
Right 975025585 4:69544293-69544315 TGGCTGTTACAGCTGCTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975025585 Original CRISPR TGGCTGTTACAGCTGCTACA TGG Intergenic
No off target data available for this crispr