ID: 975026804

View in Genome Browser
Species Human (GRCh38)
Location 4:69559130-69559152
Sequence GTGGTGGTGGCCATCATAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975026802_975026804 -10 Left 975026802 4:69559117-69559139 CCACTGTAAACTGGTGGTGGTGG No data
Right 975026804 4:69559130-69559152 GTGGTGGTGGCCATCATAAGAGG No data
975026801_975026804 -9 Left 975026801 4:69559116-69559138 CCCACTGTAAACTGGTGGTGGTG No data
Right 975026804 4:69559130-69559152 GTGGTGGTGGCCATCATAAGAGG No data
975026800_975026804 -8 Left 975026800 4:69559115-69559137 CCCCACTGTAAACTGGTGGTGGT No data
Right 975026804 4:69559130-69559152 GTGGTGGTGGCCATCATAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975026804 Original CRISPR GTGGTGGTGGCCATCATAAG AGG Intergenic
No off target data available for this crispr