ID: 975030043

View in Genome Browser
Species Human (GRCh38)
Location 4:69603625-69603647
Sequence CAGGAAGAAGTTCAAACCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2936
Summary {0: 1, 1: 6, 2: 167, 3: 1377, 4: 1385}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975030043 Original CRISPR CAGGAAGAAGTTCAAACCCA TGG Intronic