ID: 975031442

View in Genome Browser
Species Human (GRCh38)
Location 4:69622948-69622970
Sequence TATGACCCATAGCAAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975031442_975031446 2 Left 975031442 4:69622948-69622970 CCACCCACTTGCTATGGGTCATA 0: 1
1: 0
2: 1
3: 4
4: 101
Right 975031446 4:69622973-69622995 GGTCTCTTTAAAAATTGTCATGG 0: 1
1: 0
2: 2
3: 26
4: 250
975031442_975031447 3 Left 975031442 4:69622948-69622970 CCACCCACTTGCTATGGGTCATA 0: 1
1: 0
2: 1
3: 4
4: 101
Right 975031447 4:69622974-69622996 GTCTCTTTAAAAATTGTCATGGG 0: 1
1: 0
2: 2
3: 48
4: 540

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975031442 Original CRISPR TATGACCCATAGCAAGTGGG TGG (reversed) Intronic
903067713 1:20710019-20710041 AAGGTCCCATAGCAAGTAGGAGG - Intronic
904413259 1:30337893-30337915 TATTACACAGAGCTAGTGGGTGG + Intergenic
906848528 1:49221880-49221902 AATGACCCAGAGCAAGTGAGTGG + Intronic
909570311 1:77102525-77102547 CATGAGCCATAGGATGTGGGTGG + Intronic
911239863 1:95453498-95453520 TAAGTCCTATAGCAGGTGGGTGG + Intergenic
913969808 1:143406141-143406163 TATGGCCAATAGAATGTGGGCGG - Intergenic
914064181 1:144231736-144231758 TATGGCCAATAGAATGTGGGCGG - Intergenic
914114969 1:144734618-144734640 TATGGCCAATAGAATGTGGGCGG + Intergenic
916007799 1:160677914-160677936 TCTGTCCAATAGAAAGTGGGCGG - Intergenic
917272206 1:173289562-173289584 TGTGACCCATAGCCAGCAGGGGG + Intergenic
918108029 1:181429916-181429938 TGAGACCCATGGCAACTGGGCGG + Intronic
920591720 1:207225800-207225822 TAGGACCCATGGCCAATGGGAGG - Intergenic
1063450744 10:6148389-6148411 CAGGAACCATATCAAGTGGGTGG + Intronic
1067558276 10:47287203-47287225 TATGTCCCAGAGCCAGAGGGTGG + Intergenic
1070574173 10:77664987-77665009 TAAGACCCATTGGAAGTTGGAGG - Intergenic
1071474822 10:86017135-86017157 TATCACACATAGCAAGTAAGTGG - Intronic
1071894963 10:90056058-90056080 CATGATCCATAGCAAGGTGGAGG - Intergenic
1074701813 10:116098962-116098984 TATGACCCACAGCCAGTGGATGG + Intronic
1074915797 10:117953688-117953710 GATGCTCCATAGCAAGTGGAAGG - Intergenic
1075565036 10:123497123-123497145 GATGACACATAGTAAGTGGCAGG + Intergenic
1075572095 10:123553439-123553461 TTTGACCAATAGCCAGTGGCAGG + Intergenic
1075661939 10:124203441-124203463 CTTGACCCATAGCAACTGTGAGG + Intergenic
1080045814 11:27806409-27806431 TGAGACCCATAGCAACTCGGAGG + Intergenic
1080592637 11:33736674-33736696 TATGTCCCATAGCAAATCCGAGG - Intergenic
1080877637 11:36290934-36290956 CATGACCAATAGCAAATGGTGGG + Intergenic
1081134954 11:39429067-39429089 TTTGACCCCTAACAAGTGTGTGG - Intergenic
1084416216 11:69034242-69034264 GATGACCCAGAGGAAGTGAGGGG - Intergenic
1084455117 11:69263968-69263990 TATGGCCCAGTGCAGGTGGGAGG - Intergenic
1084732912 11:71084936-71084958 TAGGACCCGTAGCAATTTGGGGG - Intronic
1087644194 11:100788138-100788160 TATGAGACATACCAAGTTGGAGG - Intronic
1091444741 12:537857-537879 CCTGCCCCAGAGCAAGTGGGTGG - Intronic
1102896295 12:116601036-116601058 CATGTCTCATAGCAAGTTGGTGG - Intergenic
1106801199 13:33257928-33257950 TATGACACATAACAAGTGACAGG + Intronic
1118440456 14:65806988-65807010 TGTGCCCCATAGAAAGTTGGGGG - Intergenic
1122324032 14:100872006-100872028 TATGACACATAGGAAGAGGAGGG - Intergenic
1122496433 14:102159245-102159267 CATGACCCATAGAAAATGAGTGG - Intronic
1124221563 15:27854130-27854152 TTTGACCGATAGAATGTGGGTGG + Intronic
1127619005 15:60714938-60714960 TATGACCAAAATCAAGTGAGGGG + Intronic
1127899077 15:63327963-63327985 TAAGACCCATAGCAAGGAGAGGG + Intronic
1133610518 16:7429170-7429192 TGTGAACCAGAGCAAGTGGAGGG + Intronic
1134087795 16:11370577-11370599 CTTGACCCATAGAATGTGGGAGG + Intronic
1137543712 16:49383112-49383134 TAAGACCAATGGCCAGTGGGTGG + Intronic
1140108729 16:71984895-71984917 AATGACTCATAGCAAGAGGTGGG + Intronic
1140690976 16:77483480-77483502 TATGTCACACAGCAAGTTGGTGG + Intergenic
1142554108 17:761448-761470 TAGGAGCCATAAAAAGTGGGAGG + Intronic
1144617285 17:16788216-16788238 GCTGACCCAGAGGAAGTGGGGGG + Intronic
1144895417 17:18527458-18527480 GCTGACCCAGAGAAAGTGGGGGG - Intergenic
1146064775 17:29625560-29625582 AATCATCCATATCAAGTGGGAGG - Intergenic
1146466517 17:33090724-33090746 CATGACCCATGGAAAGTGTGGGG + Intronic
1148764530 17:50029361-50029383 TAGGTCCCACAGCAAGTGAGTGG - Intergenic
1150205371 17:63401223-63401245 TGTGACCCAAAGCTAGTTGGTGG + Intronic
1150580019 17:66464383-66464405 TATGACCCACTGCAATTGTGGGG + Intronic
1151283252 17:73092207-73092229 TAACAGCCAGAGCAAGTGGGAGG + Intronic
1151810894 17:76441043-76441065 AAGGCCACATAGCAAGTGGGAGG - Intronic
1163932021 19:20404178-20404200 TATGAGACAGAGCAAGTGTGAGG + Intergenic
1166385315 19:42377329-42377351 TGTGACCCAGATCAAGTGTGAGG + Exonic
1167120425 19:47513418-47513440 TAACACTCATAGCAAATGGGAGG + Intronic
925802994 2:7619958-7619980 TATGACCCATAGCAATTGGAAGG - Intergenic
926691927 2:15742593-15742615 TCTGACCCATAGGAAATGCGAGG - Intronic
927699035 2:25256324-25256346 CATGAGGAATAGCAAGTGGGCGG - Intronic
933262464 2:80145966-80145988 TTTGACCCATAGAATGTGGCAGG + Intronic
934284817 2:91641403-91641425 TATGGCCAATAGAATGTGGGTGG - Intergenic
935345204 2:102101426-102101448 AATGACCCATAGCATGTTGAGGG + Intronic
941454329 2:165697209-165697231 TAAGACCAATAGAAAGTGGCCGG + Intergenic
945182303 2:207104450-207104472 TATCACCCATTGAAGGTGGGTGG - Intronic
945754788 2:213832475-213832497 TATGACCCATAGTGAGAAGGAGG - Intronic
947875025 2:233462147-233462169 GATGACCCACAGCAAATGGGAGG - Intronic
1169252362 20:4070395-4070417 TATGGCCCAAAGCAAGTGACAGG - Intronic
1174351353 20:49970631-49970653 TTTGACCCACAGCAGGTGAGAGG - Intergenic
1183005335 22:34896483-34896505 TCTGATCCATCGCCAGTGGGAGG + Intergenic
1183806655 22:40217370-40217392 TATGACCCCAAGCAAGTGAGTGG + Intronic
953490643 3:43347554-43347576 TAAAACCCACAGCCAGTGGGCGG + Exonic
957525246 3:81371693-81371715 TATGACCCTTGGTAAGTGGATGG - Intergenic
960017531 3:112909212-112909234 TATGAACCACTGGAAGTGGGTGG - Intergenic
961003266 3:123388309-123388331 TATGACCAACTGAAAGTGGGAGG + Intronic
961424274 3:126832761-126832783 TCTGACCCAGAGAAAGGGGGAGG + Intronic
962300864 3:134241861-134241883 TATCAACCATAGGAAGTCGGTGG - Intronic
966427634 3:179796907-179796929 AATGTCACATAGCAAGTGTGTGG - Exonic
972750082 4:41980005-41980027 TATGTTCCATGGCAAGTGTGTGG + Intergenic
975031442 4:69622948-69622970 TATGACCCATAGCAAGTGGGTGG - Intronic
980427947 4:132651367-132651389 TATGTGTCAAAGCAAGTGGGAGG - Intergenic
982380504 4:154743455-154743477 TATCACCCAGAGCAGGAGGGCGG - Intronic
985442118 4:189989725-189989747 CATGACACCTATCAAGTGGGAGG - Intergenic
988430909 5:31117423-31117445 CATAACCCATAACAAGTGGCTGG - Intergenic
992877736 5:81074480-81074502 TATTACGTATAGAAAGTGGGGGG - Intronic
998740894 5:145200016-145200038 TGTGAACCATAGCAAATGTGGGG - Intergenic
999998262 5:157113055-157113077 TATAACCAATGGCAAGGGGGTGG - Intronic
1001963251 5:175893364-175893386 CATGAGCCAAAGAAAGTGGGCGG + Intergenic
1002186749 5:177458182-177458204 TGTGACCCAGAGGAAGTGGAAGG - Exonic
1005865667 6:29934163-29934185 GATTACCCAGCGCAAGTGGGAGG + Intergenic
1006052665 6:31356269-31356291 GATCACCCAGCGCAAGTGGGAGG - Exonic
1009047772 6:58249668-58249690 TATGAACCATATCAAGGGGTGGG - Intergenic
1011922352 6:92595311-92595333 TACTATCCAAAGCAAGTGGGTGG - Intergenic
1012837235 6:104284858-104284880 TGTGACCCATGGCAAGTGACAGG - Intergenic
1013429598 6:110043759-110043781 TATGGCCCAAAGGAAGTGTGTGG - Intergenic
1017745984 6:157447333-157447355 CATGGCCCATAGAAAGTAGGAGG - Intronic
1023175375 7:37430849-37430871 TAAGTCACAGAGCAAGTGGGTGG + Intronic
1024581537 7:50804848-50804870 TATGACCCATGGCAAATAAGGGG - Intergenic
1036619458 8:10415095-10415117 TCTGAGCCAGAGCAAATGGGTGG + Intronic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1046761875 8:118029963-118029985 TATGCCCCATACAATGTGGGTGG + Intronic
1050026724 9:1342388-1342410 TAAGAACCATAGCCAGTGTGGGG - Intergenic
1062619296 9:137412159-137412181 TGAGACCCAGAGCGAGTGGGCGG + Intronic
1191838435 X:65490329-65490351 TATGAGCCAAAGAATGTGGGTGG + Intronic
1195619769 X:106941522-106941544 TATGACTCAGAACAAGTGGATGG - Exonic
1196038064 X:111168717-111168739 TATGACCCATTCCAAATGGTGGG - Intronic
1199596239 X:149508325-149508347 TCTGACCCACAGAAAGTAGGAGG - Intronic