ID: 975033765

View in Genome Browser
Species Human (GRCh38)
Location 4:69656942-69656964
Sequence CCTCCCGGCTGCCAAAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975033765_975033773 24 Left 975033765 4:69656942-69656964 CCTTTTCTTTGGCAGCCGGGAGG No data
Right 975033773 4:69656989-69657011 AGCAGGGCTCACCCTCCACCTGG No data
975033765_975033772 8 Left 975033765 4:69656942-69656964 CCTTTTCTTTGGCAGCCGGGAGG No data
Right 975033772 4:69656973-69656995 CTCAGGCAAGTTTTCAAGCAGGG No data
975033765_975033768 -9 Left 975033765 4:69656942-69656964 CCTTTTCTTTGGCAGCCGGGAGG No data
Right 975033768 4:69656956-69656978 GCCGGGAGGTGGAAAGCCTCAGG No data
975033765_975033771 7 Left 975033765 4:69656942-69656964 CCTTTTCTTTGGCAGCCGGGAGG No data
Right 975033771 4:69656972-69656994 CCTCAGGCAAGTTTTCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975033765 Original CRISPR CCTCCCGGCTGCCAAAGAAA AGG (reversed) Intergenic
No off target data available for this crispr