ID: 975033769

View in Genome Browser
Species Human (GRCh38)
Location 4:69656957-69656979
Sequence GCCTGAGGCTTTCCACCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975033769_975033771 -8 Left 975033769 4:69656957-69656979 CCGGGAGGTGGAAAGCCTCAGGC No data
Right 975033771 4:69656972-69656994 CCTCAGGCAAGTTTTCAAGCAGG No data
975033769_975033772 -7 Left 975033769 4:69656957-69656979 CCGGGAGGTGGAAAGCCTCAGGC No data
Right 975033772 4:69656973-69656995 CTCAGGCAAGTTTTCAAGCAGGG No data
975033769_975033776 23 Left 975033769 4:69656957-69656979 CCGGGAGGTGGAAAGCCTCAGGC No data
Right 975033776 4:69657003-69657025 TCCACCTGGAAACAGACTCCAGG No data
975033769_975033773 9 Left 975033769 4:69656957-69656979 CCGGGAGGTGGAAAGCCTCAGGC No data
Right 975033773 4:69656989-69657011 AGCAGGGCTCACCCTCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975033769 Original CRISPR GCCTGAGGCTTTCCACCTCC CGG (reversed) Intergenic
No off target data available for this crispr