ID: 975033770

View in Genome Browser
Species Human (GRCh38)
Location 4:69656972-69656994
Sequence CCTGCTTGAAAACTTGCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975033770_975033781 19 Left 975033770 4:69656972-69656994 CCTCAGGCAAGTTTTCAAGCAGG No data
Right 975033781 4:69657014-69657036 ACAGACTCCAGGTTGTTGAGGGG No data
975033770_975033784 26 Left 975033770 4:69656972-69656994 CCTCAGGCAAGTTTTCAAGCAGG No data
Right 975033784 4:69657021-69657043 CCAGGTTGTTGAGGGGGACACGG No data
975033770_975033773 -6 Left 975033770 4:69656972-69656994 CCTCAGGCAAGTTTTCAAGCAGG No data
Right 975033773 4:69656989-69657011 AGCAGGGCTCACCCTCCACCTGG No data
975033770_975033780 18 Left 975033770 4:69656972-69656994 CCTCAGGCAAGTTTTCAAGCAGG No data
Right 975033780 4:69657013-69657035 AACAGACTCCAGGTTGTTGAGGG No data
975033770_975033782 20 Left 975033770 4:69656972-69656994 CCTCAGGCAAGTTTTCAAGCAGG No data
Right 975033782 4:69657015-69657037 CAGACTCCAGGTTGTTGAGGGGG No data
975033770_975033786 30 Left 975033770 4:69656972-69656994 CCTCAGGCAAGTTTTCAAGCAGG No data
Right 975033786 4:69657025-69657047 GTTGTTGAGGGGGACACGGTGGG No data
975033770_975033779 17 Left 975033770 4:69656972-69656994 CCTCAGGCAAGTTTTCAAGCAGG No data
Right 975033779 4:69657012-69657034 AAACAGACTCCAGGTTGTTGAGG No data
975033770_975033776 8 Left 975033770 4:69656972-69656994 CCTCAGGCAAGTTTTCAAGCAGG No data
Right 975033776 4:69657003-69657025 TCCACCTGGAAACAGACTCCAGG No data
975033770_975033785 29 Left 975033770 4:69656972-69656994 CCTCAGGCAAGTTTTCAAGCAGG No data
Right 975033785 4:69657024-69657046 GGTTGTTGAGGGGGACACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975033770 Original CRISPR CCTGCTTGAAAACTTGCCTG AGG (reversed) Intergenic
No off target data available for this crispr