ID: 975033772

View in Genome Browser
Species Human (GRCh38)
Location 4:69656973-69656995
Sequence CTCAGGCAAGTTTTCAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975033769_975033772 -7 Left 975033769 4:69656957-69656979 CCGGGAGGTGGAAAGCCTCAGGC No data
Right 975033772 4:69656973-69656995 CTCAGGCAAGTTTTCAAGCAGGG No data
975033765_975033772 8 Left 975033765 4:69656942-69656964 CCTTTTCTTTGGCAGCCGGGAGG No data
Right 975033772 4:69656973-69656995 CTCAGGCAAGTTTTCAAGCAGGG No data
975033764_975033772 9 Left 975033764 4:69656941-69656963 CCCTTTTCTTTGGCAGCCGGGAG No data
Right 975033772 4:69656973-69656995 CTCAGGCAAGTTTTCAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975033772 Original CRISPR CTCAGGCAAGTTTTCAAGCA GGG Intergenic
No off target data available for this crispr