ID: 975033773

View in Genome Browser
Species Human (GRCh38)
Location 4:69656989-69657011
Sequence AGCAGGGCTCACCCTCCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975033769_975033773 9 Left 975033769 4:69656957-69656979 CCGGGAGGTGGAAAGCCTCAGGC No data
Right 975033773 4:69656989-69657011 AGCAGGGCTCACCCTCCACCTGG No data
975033764_975033773 25 Left 975033764 4:69656941-69656963 CCCTTTTCTTTGGCAGCCGGGAG No data
Right 975033773 4:69656989-69657011 AGCAGGGCTCACCCTCCACCTGG No data
975033765_975033773 24 Left 975033765 4:69656942-69656964 CCTTTTCTTTGGCAGCCGGGAGG No data
Right 975033773 4:69656989-69657011 AGCAGGGCTCACCCTCCACCTGG No data
975033770_975033773 -6 Left 975033770 4:69656972-69656994 CCTCAGGCAAGTTTTCAAGCAGG No data
Right 975033773 4:69656989-69657011 AGCAGGGCTCACCCTCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975033773 Original CRISPR AGCAGGGCTCACCCTCCACC TGG Intergenic
No off target data available for this crispr