ID: 975033774

View in Genome Browser
Species Human (GRCh38)
Location 4:69657000-69657022
Sequence GGAGTCTGTTTCCAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975033774_975033787 13 Left 975033774 4:69657000-69657022 CCCTCCACCTGGAAACAGACTCC No data
Right 975033787 4:69657036-69657058 GGACACGGTGGGAGTGAGACTGG No data
975033774_975033784 -2 Left 975033774 4:69657000-69657022 CCCTCCACCTGGAAACAGACTCC No data
Right 975033784 4:69657021-69657043 CCAGGTTGTTGAGGGGGACACGG No data
975033774_975033780 -10 Left 975033774 4:69657000-69657022 CCCTCCACCTGGAAACAGACTCC No data
Right 975033780 4:69657013-69657035 AACAGACTCCAGGTTGTTGAGGG No data
975033774_975033782 -8 Left 975033774 4:69657000-69657022 CCCTCCACCTGGAAACAGACTCC No data
Right 975033782 4:69657015-69657037 CAGACTCCAGGTTGTTGAGGGGG No data
975033774_975033781 -9 Left 975033774 4:69657000-69657022 CCCTCCACCTGGAAACAGACTCC No data
Right 975033781 4:69657014-69657036 ACAGACTCCAGGTTGTTGAGGGG No data
975033774_975033786 2 Left 975033774 4:69657000-69657022 CCCTCCACCTGGAAACAGACTCC No data
Right 975033786 4:69657025-69657047 GTTGTTGAGGGGGACACGGTGGG No data
975033774_975033785 1 Left 975033774 4:69657000-69657022 CCCTCCACCTGGAAACAGACTCC No data
Right 975033785 4:69657024-69657046 GGTTGTTGAGGGGGACACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975033774 Original CRISPR GGAGTCTGTTTCCAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr