ID: 975033775

View in Genome Browser
Species Human (GRCh38)
Location 4:69657001-69657023
Sequence TGGAGTCTGTTTCCAGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975033775_975033784 -3 Left 975033775 4:69657001-69657023 CCTCCACCTGGAAACAGACTCCA No data
Right 975033784 4:69657021-69657043 CCAGGTTGTTGAGGGGGACACGG No data
975033775_975033787 12 Left 975033775 4:69657001-69657023 CCTCCACCTGGAAACAGACTCCA No data
Right 975033787 4:69657036-69657058 GGACACGGTGGGAGTGAGACTGG No data
975033775_975033782 -9 Left 975033775 4:69657001-69657023 CCTCCACCTGGAAACAGACTCCA No data
Right 975033782 4:69657015-69657037 CAGACTCCAGGTTGTTGAGGGGG No data
975033775_975033781 -10 Left 975033775 4:69657001-69657023 CCTCCACCTGGAAACAGACTCCA No data
Right 975033781 4:69657014-69657036 ACAGACTCCAGGTTGTTGAGGGG No data
975033775_975033785 0 Left 975033775 4:69657001-69657023 CCTCCACCTGGAAACAGACTCCA No data
Right 975033785 4:69657024-69657046 GGTTGTTGAGGGGGACACGGTGG No data
975033775_975033786 1 Left 975033775 4:69657001-69657023 CCTCCACCTGGAAACAGACTCCA No data
Right 975033786 4:69657025-69657047 GTTGTTGAGGGGGACACGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975033775 Original CRISPR TGGAGTCTGTTTCCAGGTGG AGG (reversed) Intergenic