ID: 975033776

View in Genome Browser
Species Human (GRCh38)
Location 4:69657003-69657025
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975033769_975033776 23 Left 975033769 4:69656957-69656979 CCGGGAGGTGGAAAGCCTCAGGC No data
Right 975033776 4:69657003-69657025 TCCACCTGGAAACAGACTCCAGG No data
975033770_975033776 8 Left 975033770 4:69656972-69656994 CCTCAGGCAAGTTTTCAAGCAGG No data
Right 975033776 4:69657003-69657025 TCCACCTGGAAACAGACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr