ID: 975033777

View in Genome Browser
Species Human (GRCh38)
Location 4:69657004-69657026
Sequence ACCTGGAGTCTGTTTCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975033777_975033785 -3 Left 975033777 4:69657004-69657026 CCACCTGGAAACAGACTCCAGGT No data
Right 975033785 4:69657024-69657046 GGTTGTTGAGGGGGACACGGTGG No data
975033777_975033787 9 Left 975033777 4:69657004-69657026 CCACCTGGAAACAGACTCCAGGT No data
Right 975033787 4:69657036-69657058 GGACACGGTGGGAGTGAGACTGG No data
975033777_975033786 -2 Left 975033777 4:69657004-69657026 CCACCTGGAAACAGACTCCAGGT No data
Right 975033786 4:69657025-69657047 GTTGTTGAGGGGGACACGGTGGG No data
975033777_975033784 -6 Left 975033777 4:69657004-69657026 CCACCTGGAAACAGACTCCAGGT No data
Right 975033784 4:69657021-69657043 CCAGGTTGTTGAGGGGGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975033777 Original CRISPR ACCTGGAGTCTGTTTCCAGG TGG (reversed) Intergenic
No off target data available for this crispr