ID: 975033779

View in Genome Browser
Species Human (GRCh38)
Location 4:69657012-69657034
Sequence AAACAGACTCCAGGTTGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975033770_975033779 17 Left 975033770 4:69656972-69656994 CCTCAGGCAAGTTTTCAAGCAGG No data
Right 975033779 4:69657012-69657034 AAACAGACTCCAGGTTGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975033779 Original CRISPR AAACAGACTCCAGGTTGTTG AGG Intergenic
No off target data available for this crispr