ID: 975033780

View in Genome Browser
Species Human (GRCh38)
Location 4:69657013-69657035
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975033774_975033780 -10 Left 975033774 4:69657000-69657022 CCCTCCACCTGGAAACAGACTCC No data
Right 975033780 4:69657013-69657035 AACAGACTCCAGGTTGTTGAGGG No data
975033770_975033780 18 Left 975033770 4:69656972-69656994 CCTCAGGCAAGTTTTCAAGCAGG No data
Right 975033780 4:69657013-69657035 AACAGACTCCAGGTTGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type