ID: 975033780 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:69657013-69657035 |
Sequence | AACAGACTCCAGGTTGTTGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
975033774_975033780 | -10 | Left | 975033774 | 4:69657000-69657022 | CCCTCCACCTGGAAACAGACTCC | No data | ||
Right | 975033780 | 4:69657013-69657035 | AACAGACTCCAGGTTGTTGAGGG | No data | ||||
975033770_975033780 | 18 | Left | 975033770 | 4:69656972-69656994 | CCTCAGGCAAGTTTTCAAGCAGG | No data | ||
Right | 975033780 | 4:69657013-69657035 | AACAGACTCCAGGTTGTTGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
975033780 | Original CRISPR | AACAGACTCCAGGTTGTTGA GGG | Intergenic | ||