ID: 975033781

View in Genome Browser
Species Human (GRCh38)
Location 4:69657014-69657036
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975033775_975033781 -10 Left 975033775 4:69657001-69657023 CCTCCACCTGGAAACAGACTCCA No data
Right 975033781 4:69657014-69657036 ACAGACTCCAGGTTGTTGAGGGG No data
975033770_975033781 19 Left 975033770 4:69656972-69656994 CCTCAGGCAAGTTTTCAAGCAGG No data
Right 975033781 4:69657014-69657036 ACAGACTCCAGGTTGTTGAGGGG No data
975033774_975033781 -9 Left 975033774 4:69657000-69657022 CCCTCCACCTGGAAACAGACTCC No data
Right 975033781 4:69657014-69657036 ACAGACTCCAGGTTGTTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type