ID: 975033784

View in Genome Browser
Species Human (GRCh38)
Location 4:69657021-69657043
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975033770_975033784 26 Left 975033770 4:69656972-69656994 CCTCAGGCAAGTTTTCAAGCAGG No data
Right 975033784 4:69657021-69657043 CCAGGTTGTTGAGGGGGACACGG No data
975033778_975033784 -9 Left 975033778 4:69657007-69657029 CCTGGAAACAGACTCCAGGTTGT No data
Right 975033784 4:69657021-69657043 CCAGGTTGTTGAGGGGGACACGG No data
975033777_975033784 -6 Left 975033777 4:69657004-69657026 CCACCTGGAAACAGACTCCAGGT No data
Right 975033784 4:69657021-69657043 CCAGGTTGTTGAGGGGGACACGG No data
975033774_975033784 -2 Left 975033774 4:69657000-69657022 CCCTCCACCTGGAAACAGACTCC No data
Right 975033784 4:69657021-69657043 CCAGGTTGTTGAGGGGGACACGG No data
975033775_975033784 -3 Left 975033775 4:69657001-69657023 CCTCCACCTGGAAACAGACTCCA No data
Right 975033784 4:69657021-69657043 CCAGGTTGTTGAGGGGGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type