ID: 975033787

View in Genome Browser
Species Human (GRCh38)
Location 4:69657036-69657058
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975033783_975033787 -8 Left 975033783 4:69657021-69657043 CCAGGTTGTTGAGGGGGACACGG No data
Right 975033787 4:69657036-69657058 GGACACGGTGGGAGTGAGACTGG No data
975033777_975033787 9 Left 975033777 4:69657004-69657026 CCACCTGGAAACAGACTCCAGGT No data
Right 975033787 4:69657036-69657058 GGACACGGTGGGAGTGAGACTGG No data
975033774_975033787 13 Left 975033774 4:69657000-69657022 CCCTCCACCTGGAAACAGACTCC No data
Right 975033787 4:69657036-69657058 GGACACGGTGGGAGTGAGACTGG No data
975033775_975033787 12 Left 975033775 4:69657001-69657023 CCTCCACCTGGAAACAGACTCCA No data
Right 975033787 4:69657036-69657058 GGACACGGTGGGAGTGAGACTGG No data
975033778_975033787 6 Left 975033778 4:69657007-69657029 CCTGGAAACAGACTCCAGGTTGT No data
Right 975033787 4:69657036-69657058 GGACACGGTGGGAGTGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr