ID: 975040955

View in Genome Browser
Species Human (GRCh38)
Location 4:69743855-69743877
Sequence GGCCCCCACCTTGTTCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975040955_975040960 10 Left 975040955 4:69743855-69743877 CCTGTGGGAACAAGGTGGGGGCC 0: 1
1: 0
2: 1
3: 16
4: 149
Right 975040960 4:69743888-69743910 TCCTAGATTGCAGAAATGCCTGG No data
975040955_975040965 29 Left 975040955 4:69743855-69743877 CCTGTGGGAACAAGGTGGGGGCC 0: 1
1: 0
2: 1
3: 16
4: 149
Right 975040965 4:69743907-69743929 CTGGGTCAACAGCTGCGCATGGG 0: 1
1: 0
2: 1
3: 5
4: 144
975040955_975040962 11 Left 975040955 4:69743855-69743877 CCTGTGGGAACAAGGTGGGGGCC 0: 1
1: 0
2: 1
3: 16
4: 149
Right 975040962 4:69743889-69743911 CCTAGATTGCAGAAATGCCTGGG 0: 1
1: 0
2: 5
3: 67
4: 266
975040955_975040964 28 Left 975040955 4:69743855-69743877 CCTGTGGGAACAAGGTGGGGGCC 0: 1
1: 0
2: 1
3: 16
4: 149
Right 975040964 4:69743906-69743928 CCTGGGTCAACAGCTGCGCATGG 0: 1
1: 0
2: 4
3: 74
4: 457

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975040955 Original CRISPR GGCCCCCACCTTGTTCCCAC AGG (reversed) Intronic
900087087 1:903928-903950 TGCCCCAACCTTGTGCCCGCTGG - Intergenic
900512025 1:3065274-3065296 CACCCCCACCTTGTTCCTCCGGG - Intergenic
903853589 1:26322299-26322321 GGCCCCCACCATGAGCCTACAGG - Exonic
904256668 1:29259068-29259090 GGCCTCCACCTTGTTCACTATGG + Intronic
906609698 1:47192772-47192794 GGGGCCCACCTTGTTACCATGGG - Intergenic
910676642 1:89821849-89821871 GGCCCCCAGCTCCCTCCCACAGG - Intronic
912318895 1:108692303-108692325 GCCCGCCATCTTGTTCCCAGGGG + Exonic
912466317 1:109877319-109877341 TGCCCCCACCTTGTGCCCCCAGG + Intergenic
1064151889 10:12872256-12872278 GGCCCTCTCCTTTTTCACACAGG - Intergenic
1064628188 10:17282847-17282869 TGCCCCCACCGAGTCCCCACTGG + Intergenic
1067792724 10:49299980-49300002 GGCCCCCACCAGACTCCCACAGG + Intronic
1071601104 10:86959148-86959170 GGCCCCCACCCTCTCCACACGGG + Intronic
1074531814 10:114303603-114303625 GGCCCCCACTTAGTTTCAACTGG + Intronic
1075823654 10:125335236-125335258 TGCCCCCAACGTTTTCCCACTGG + Intergenic
1077957777 11:7039475-7039497 GGCCCCCACCTTGTAGCTCCAGG - Intronic
1080899396 11:36473283-36473305 GTTCCCTACCTTGTGCCCACTGG - Intergenic
1081618281 11:44603375-44603397 GGTCCCCACCTTGGTCCCCAAGG - Intronic
1083136074 11:60678062-60678084 GGCCCCCACAGAGTCCCCACTGG - Intergenic
1084597833 11:70127668-70127690 GGGCCCCACTCTGTTCCCCCAGG - Intronic
1089358987 11:117874098-117874120 TTCCCCCACTGTGTTCCCACTGG + Intronic
1090915520 11:131159303-131159325 GGCCCACACCTTTCTCCCAGTGG + Intergenic
1091800853 12:3323638-3323660 GGCCACCACACTGTTCTCACAGG - Intergenic
1093958839 12:25251089-25251111 GGCCCCCTCCTTCTCCCCGCCGG - Intergenic
1095559753 12:43551558-43551580 AGCCCCCAACTCGTTCCCTCCGG + Intronic
1096542350 12:52314818-52314840 GACCCTGCCCTTGTTCCCACAGG - Exonic
1096827684 12:54292383-54292405 GGCCTCCATCTTGGTCCCCCGGG + Exonic
1097702253 12:62832050-62832072 GGCACACACTTTGGTCCCACTGG - Intronic
1103435990 12:120925819-120925841 GGTCCACACCTCCTTCCCACAGG + Intergenic
1104269008 12:127265075-127265097 GGGCCCCACCTTGTACCCTAAGG - Intergenic
1104997617 12:132668425-132668447 GTTCCCCCCCTTGTTCCCAGAGG - Exonic
1107601342 13:42016027-42016049 GGCCACCACATTGTGGCCACAGG - Intergenic
1114280812 14:21191441-21191463 GGACACCATCTTGTTACCACTGG - Intergenic
1115520774 14:34231088-34231110 GGCCCACTCCATGTTCCCAGTGG - Intronic
1121118324 14:91359092-91359114 GGCCACCGCCTTGTTCCTCCTGG - Intronic
1121291229 14:92777199-92777221 GGGCCCCAGCCTGATCCCACAGG - Intergenic
1122013520 14:98773528-98773550 GGCCACCACCATTTTCCCCCAGG + Intergenic
1123995371 15:25714294-25714316 GGCCCCACCCTGGTTCCCACAGG + Intronic
1129414573 15:75368213-75368235 GGCCTCCAGCATGTGCCCACCGG - Intronic
1132864586 16:2087168-2087190 GGCCCCCACCATCTCCCCAGTGG + Intronic
1132949427 16:2552552-2552574 TGCCCCCTACTTATTCCCACAGG - Intronic
1132964921 16:2647614-2647636 TGCCCCCTACTTATTCCCACAGG + Intergenic
1133421839 16:5653064-5653086 GCACCCCACCTTGCTCACACAGG - Intergenic
1134114681 16:11539062-11539084 GGCCCCCACATTCCTTCCACCGG - Intergenic
1136377895 16:29876397-29876419 GGCTCCGACCAGGTTCCCACTGG - Intronic
1137729049 16:50676662-50676684 GCTTCCCACCTTGTTCCTACAGG + Intronic
1137978869 16:53053424-53053446 GGCCCCCACTCTGCTCCCCCAGG - Intergenic
1138120595 16:54398041-54398063 GGGCTCCACCCTGTTCCCACTGG - Intergenic
1139429978 16:66905884-66905906 GGCCCCCACCTTGCTCTAGCAGG + Intergenic
1141665850 16:85464762-85464784 GGCCCTCACTTTGTTTCCAAAGG + Intergenic
1142182624 16:88678629-88678651 GGCCGCCGCCTTCCTCCCACAGG - Exonic
1142679610 17:1538952-1538974 GGTTCCCCACTTGTTCCCACAGG - Exonic
1142809060 17:2386856-2386878 GTCCCCCTCCCTGTCCCCACTGG + Exonic
1143013381 17:3878709-3878731 GATCCCCACCCTGTTCCCCCAGG + Intronic
1144852772 17:18252339-18252361 GGGGCCCACCTTCTCCCCACGGG + Intronic
1145846217 17:28041588-28041610 GACCCACACCTTGTTGCCACTGG + Intergenic
1145932719 17:28697598-28697620 GGCCTTTACCTTCTTCCCACAGG + Exonic
1146733283 17:35214279-35214301 TGCCCCCATCTTGTTCCTAGGGG + Intergenic
1147460484 17:40565149-40565171 GGCCCCTCCCTTGTCCCCACTGG + Intronic
1148393995 17:47294285-47294307 GTCCCCAACCTTCTTCCCAGGGG - Intronic
1151536328 17:74740944-74740966 TGCCCCCACCTTGCTCACCCTGG + Intronic
1152407201 17:80104597-80104619 GGCACCCGCCCTGCTCCCACCGG + Intergenic
1152713736 17:81888212-81888234 GGCCCCCAGCTGGCTCCCCCGGG + Intronic
1152784529 17:82240962-82240984 TGCCCCCAGCTTCTTCCCAGTGG - Intronic
1153179149 18:2413463-2413485 GGCCTCCTCCTATTTCCCACTGG + Intergenic
1159705450 18:71680030-71680052 GGCCCCCACACAGTCCCCACTGG + Intergenic
1161989846 19:7678424-7678446 GACCCCCACCATGACCCCACGGG - Intronic
1162234577 19:9297937-9297959 GGTCCTCCTCTTGTTCCCACTGG + Exonic
1162792911 19:13072218-13072240 GCCCCCCACCCTGGTCCCCCTGG - Intronic
1163062624 19:14771412-14771434 CGCACCCAACTAGTTCCCACTGG + Intronic
1165711013 19:38011116-38011138 GGCTCTCACCTTGTTCACAATGG - Intronic
1165722968 19:38092792-38092814 GTCCCCCACCTTGTCACCATGGG - Intronic
1165900621 19:39167676-39167698 GGCCCCCACCCCCCTCCCACGGG + Intronic
1168608681 19:57780905-57780927 GACCCCCAGCTTGTGTCCACGGG + Intronic
927844602 2:26464928-26464950 GGCCCCCACTTTGGGCCCCCTGG - Exonic
927857242 2:26535398-26535420 GGCTGCCACCATCTTCCCACGGG + Intronic
928123297 2:28599296-28599318 GGCCCCCACCCTGCTCCTAGAGG + Intronic
929668611 2:43852473-43852495 GGCCCTCACCTGGGTTCCACAGG - Exonic
930544148 2:52745855-52745877 GGCCCACACAGAGTTCCCACTGG + Intergenic
931300378 2:60973359-60973381 GGCCCCCCCGTTGTCCCCACAGG + Intronic
932705250 2:74019755-74019777 GGCACCCTCCTTGTCCCCGCAGG + Intronic
937334393 2:121052609-121052631 GTCCCCCACCCTGTCCCCACTGG + Intergenic
947712013 2:232321787-232321809 GGCCCCCCCTTTGTTTCCAGGGG + Intronic
948757168 2:240166543-240166565 GGCCCCCACCTACTGCACACCGG + Intergenic
1171181903 20:23097132-23097154 GCCGCCCACTTTGTTCCCACGGG - Intergenic
1172426848 20:34861436-34861458 GGTCCCCACCTTGGTCTCCCAGG + Exonic
1172446365 20:34995565-34995587 GGCCCACACCTTGTTCTCAGTGG - Exonic
1172846026 20:37930438-37930460 GGCCCCCACCCTGTCCCTCCTGG - Intronic
1179708030 21:43193820-43193842 AGGCCCCTCCTGGTTCCCACAGG + Intergenic
1179822692 21:43945904-43945926 AGCCCCCACCAGGTGCCCACAGG - Intronic
1179822706 21:43945967-43945989 GCCCTCCACCTTGTCCCCGCAGG + Intronic
1181685676 22:24526155-24526177 AGCCCTCACCCTCTTCCCACTGG - Exonic
1182443896 22:30379439-30379461 GGGCCCCACCATGTCCACACTGG - Exonic
1182572309 22:31248513-31248535 GGCCCCCAGCAGATTCCCACAGG - Exonic
1183347382 22:37315375-37315397 GGCTGCCACCTTGACCCCACCGG + Intergenic
1183431117 22:37766257-37766279 GGGCCCCACATGTTTCCCACAGG + Intronic
1184131242 22:42517955-42517977 AGCCCCCACCTTGAGCCCACAGG + Intronic
1185367890 22:50445364-50445386 GGGCCCCACCTTGTCCTCAGTGG + Exonic
950579367 3:13852506-13852528 GACCCACTCCTTGTTCCGACCGG - Intronic
952575846 3:34773401-34773423 GTCCCCCACAGAGTTCCCACTGG + Intergenic
952973407 3:38671684-38671706 GAACCCCACCTGGTTCTCACAGG - Intergenic
954109643 3:48426860-48426882 GCCCCCCACCTAGTTTCCAAGGG + Intronic
955739091 3:62070816-62070838 GTCCACCACCACGTTCCCACTGG + Intronic
956441764 3:69287743-69287765 GGCACCTACCTTGTGCACACAGG + Exonic
957440857 3:80245446-80245468 GGCCACCACCTTATTCTCTCTGG + Intergenic
960087977 3:113611149-113611171 GTCCCCCACCTTCTTCCACCTGG + Intronic
961315015 3:126028597-126028619 GCCCCCCACACAGTTCCCACTGG + Intronic
962263327 3:133928477-133928499 GGCCCCCACCTTGCTCACCTGGG - Exonic
963893492 3:150661071-150661093 TGCCCCCACCTTGTTTCCAGCGG + Intronic
969052780 4:4385257-4385279 GGCCTCCACTTTGTTCCTCCTGG + Intronic
969497798 4:7535845-7535867 TGCACCCACCTGGTTCCCTCAGG + Intronic
975040955 4:69743855-69743877 GGCCCCCACCTTGTTCCCACAGG - Intronic
980579639 4:134732735-134732757 GCCCCCCACAATGTTCCCACTGG + Intergenic
984823333 4:183903783-183903805 GCCCCCAACCTTTTTCACACTGG + Intronic
985508414 5:298439-298461 CGTCCCCTCCTTCTTCCCACTGG - Intronic
985739632 5:1607229-1607251 CGTCCCCTCCTTCTTCCCACTGG + Intergenic
986290245 5:6393932-6393954 GGCACCCACCTTTCCCCCACTGG - Intergenic
987545889 5:19309764-19309786 AGCCCCCACCCAGTCCCCACTGG - Intergenic
991549924 5:67824730-67824752 GGTTCCCACCTTGTTCCCTGAGG - Intergenic
992939999 5:81751708-81751730 CGCCCCCGCCCTGTTCCCAGAGG + Intronic
992994405 5:82318312-82318334 GGCCCCCACCATGTCCACAGTGG + Exonic
993409928 5:87560747-87560769 GGCCACCACATTGCTCACACTGG - Intergenic
994535508 5:101025231-101025253 AGCCCCCACAGAGTTCCCACTGG - Intergenic
997978432 5:138454010-138454032 GGGCCCCACAGTGTGCCCACAGG - Intergenic
998427299 5:142039714-142039736 TGCCACCACCTTGTTCTTACTGG - Intergenic
999757548 5:154676207-154676229 GGCCTCCACCTTGTTCTCCCTGG + Intergenic
1000181732 5:158818076-158818098 GGACCCCACCTGGCTCTCACTGG + Intronic
1002182909 5:177440824-177440846 GGCCCCCACCTCGTTCTGCCAGG - Exonic
1002235889 5:177802632-177802654 GCAGCCCACCTTGATCCCACTGG + Intergenic
1002546033 5:179945899-179945921 TGCCCCCGCCTTTTTCCCTCCGG - Intronic
1002777643 6:342386-342408 GGCACCCTCCTTGGTCCCCCAGG - Intronic
1004012237 6:11701081-11701103 AGCGCCCTCCTTCTTCCCACTGG - Intergenic
1006105703 6:31715186-31715208 GGGCCCCTCCCTGTCCCCACTGG + Intronic
1006347923 6:33498128-33498150 GGCCCCAACCCGGTTCCCACTGG - Intergenic
1012029231 6:94037198-94037220 AGCCCCCACACAGTTCCCACTGG + Intergenic
1012068203 6:94577194-94577216 AGCCCCCACAGAGTTCCCACTGG - Intergenic
1014670765 6:124301419-124301441 AGCCCCTACATTGTCCCCACTGG + Intronic
1016843153 6:148544465-148544487 GGACTCCACCCTGTTCCCATGGG + Exonic
1017875048 6:158517237-158517259 GTCCCCCAGCTTATTCCCAAGGG + Intergenic
1017938067 6:159024805-159024827 AGCTCCCACCAAGTTCCCACTGG - Intergenic
1021247705 7:18284099-18284121 GGCCACCAAATTGTTCCCATTGG + Intronic
1022992091 7:35718693-35718715 GCCCCCAACCTTATCCCCACAGG + Intergenic
1025635090 7:63314714-63314736 AGCCCCCACCATGGTCCCCCTGG - Intergenic
1025647605 7:63433456-63433478 AGCCCCCACCATGGTCCCCCTGG + Intergenic
1027894786 7:84026691-84026713 GGCCCCATCCATGTTCCTACAGG - Intronic
1028504735 7:91558548-91558570 GGTTCCCACCTTGTTTCAACTGG - Intergenic
1029539127 7:101172752-101172774 GGCTCCCACCTGGGTCCCTCTGG + Intronic
1036752360 8:11451288-11451310 GGCCCCCAGCTCCTTGCCACTGG - Intronic
1037947598 8:22999187-22999209 GGCCCCCACCACTTGCCCACGGG - Intronic
1040059405 8:43091813-43091835 GGCCACCATTTTGTGCCCACAGG - Intergenic
1040078045 8:43260083-43260105 GCCCCCCACAGAGTTCCCACAGG - Intergenic
1042963707 8:74329135-74329157 GTCCCCCACCTGGGTTCCACTGG + Intronic
1045757444 8:105561422-105561444 GGCCCCCAGGTTGTTCCCACTGG - Exonic
1048031165 8:130633668-130633690 AGCTCCCTCCTTGGTCCCACTGG - Intergenic
1049180089 8:141217816-141217838 GGCCCCCACCAAGTTCCCAGAGG + Intronic
1061883458 9:133579207-133579229 GCCCCCCACCTTCTTCCTGCAGG - Exonic
1061994910 9:134178366-134178388 GGCCCCCTGCTTGTGCCCTCTGG - Intergenic
1062146938 9:134994715-134994737 GGGCCACACCTGGTTCCCAAGGG - Intergenic
1185469614 X:374575-374597 GGCCTGCACCTCGATCCCACCGG + Intronic
1185594741 X:1299071-1299093 GGCCCCCTCATAGTTCTCACTGG + Intronic
1186805771 X:13139182-13139204 GGCCCCCGCCCTGCTCTCACAGG + Intergenic
1187465751 X:19526150-19526172 GAACCCCACCTGGTTCTCACAGG - Intergenic
1192543762 X:71996156-71996178 GGCCCCCACCTTGCCCCCAGAGG - Intergenic
1194032713 X:88836096-88836118 CGCCCCCACACAGTTCCCACTGG - Intergenic
1197721057 X:129744956-129744978 CGCCCCCACACTGTTCACACTGG - Intronic
1197760867 X:130027134-130027156 GCCCCCCACCTTGTTTACCCAGG - Intronic
1199071182 X:143477195-143477217 AGCCCCCACAGAGTTCCCACTGG + Intergenic
1199888690 X:152051421-152051443 GGCCCCTACCTTTTTATCACAGG - Intergenic