ID: 975041057

View in Genome Browser
Species Human (GRCh38)
Location 4:69744287-69744309
Sequence CAGCGGAGGCGCAGCGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 287}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975041050_975041057 -5 Left 975041050 4:69744269-69744291 CCTCTCTGTGTTTCCCCTCAGCG 0: 1
1: 0
2: 0
3: 21
4: 198
Right 975041057 4:69744287-69744309 CAGCGGAGGCGCAGCGGCCCTGG 0: 1
1: 0
2: 4
3: 24
4: 287
975041049_975041057 25 Left 975041049 4:69744239-69744261 CCAGGGGTGGACTCTAGGGACTG 0: 1
1: 3
2: 2
3: 16
4: 161
Right 975041057 4:69744287-69744309 CAGCGGAGGCGCAGCGGCCCTGG 0: 1
1: 0
2: 4
3: 24
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975041057 Original CRISPR CAGCGGAGGCGCAGCGGCCC TGG Intronic
900244858 1:1632145-1632167 CCCCGGAGGCTCTGCGGCCCGGG + Exonic
900403315 1:2481730-2481752 TAGTGGAGGCCCAGTGGCCCTGG + Intronic
901634475 1:10664227-10664249 CAGGGGAGGCGCAGGGCACCGGG + Intronic
902933352 1:19746519-19746541 CAGCGCCGGGGCAGCGGCTCTGG - Exonic
903743150 1:25570015-25570037 CAGCTGAGGGGCAGAGGCCTGGG - Intergenic
903750443 1:25617583-25617605 AGGCGGGGGCGCAGCGGCCTCGG - Exonic
905172080 1:36115336-36115358 CAGGGTAGCCGCAGAGGCCCAGG - Intronic
905505585 1:38476582-38476604 GAGCGGAGGGGCAGGGGCGCGGG - Intergenic
905922757 1:41730260-41730282 CAGGTGAGGGGCAGAGGCCCAGG - Intronic
906917207 1:50024040-50024062 TTGCGGAGGAGCAGCGCCCCGGG - Intergenic
912492631 1:110070499-110070521 CAGGTGAGGCGCAGCGGCGGGGG + Exonic
912558483 1:110533409-110533431 CAGCGGCAGCTCAGCTGCCCTGG - Intergenic
912800163 1:112715236-112715258 GCGCGGAGGCGGAGCGCCCCCGG + Exonic
915310588 1:155004099-155004121 CAGGGGAGGGGCAGAGGCGCCGG + Intronic
915519916 1:156436148-156436170 CGGCGGGTGCGCAGCGGCCGGGG + Intergenic
916738797 1:167630491-167630513 CAGGGCAGGGGCAGCCGCCCGGG - Intronic
918151095 1:181798745-181798767 CGGCGGAGGCGCGGGGGGCCTGG + Exonic
921029797 1:211327056-211327078 CGGGGGAGGCGGAGGGGCCCGGG + Intronic
923038356 1:230301201-230301223 CTGCAGAGGCTCAGTGGCCCTGG + Intergenic
1063207978 10:3853175-3853197 CAGCGGCGGCTCAACTGCCCAGG + Intergenic
1063493929 10:6489650-6489672 CAGTGGAGGGGCAGGGACCCGGG + Intronic
1065712567 10:28532508-28532530 CCGGTGAGGGGCAGCGGCCCGGG + Intronic
1065965069 10:30764180-30764202 CAGCGTTGGTGCAGCGGGCCTGG + Intergenic
1065968177 10:30785313-30785335 CTGCGGAGGCCGGGCGGCCCTGG - Intergenic
1066094141 10:32056446-32056468 CTGCGCAGGCGCAGTGGGCCAGG + Intergenic
1067696322 10:48537962-48537984 CTGCGGAGGGCCAGTGGCCCTGG + Intronic
1068637376 10:59362614-59362636 CAGCAGGGGCCCAGCGGCACGGG + Intronic
1069819272 10:71217544-71217566 CCGCGGGGGCGCAGCGGCTGAGG - Intronic
1070800829 10:79243551-79243573 CGGCGGCGGCGCGGGGGCCCGGG - Intronic
1072443878 10:95481089-95481111 CAGGGGAGGTACAGGGGCCCCGG - Intronic
1074231311 10:111538695-111538717 CAGCTGAGAAGCAGCAGCCCTGG + Intergenic
1074865457 10:117542240-117542262 CAGCGGAGGCGGCGCCGGCCAGG + Intergenic
1075627412 10:123972783-123972805 CAGCGGACGCCCACCCGCCCGGG - Intergenic
1076149448 10:128150364-128150386 CAGGCGAGGCGCAGCGGGACGGG + Intergenic
1076916528 10:133425142-133425164 CACCGGAGGCGCGGCCGCCCTGG - Intergenic
1076936632 10:133569937-133569959 CACCGGAGGCGCGGCCGCCCTGG - Intergenic
1077169810 11:1161087-1161109 CCGTGGAGGCCCAGCAGCCCTGG + Intronic
1077368149 11:2169548-2169570 TAGCAGAGGTGCAGCTGCCCAGG - Intronic
1077545246 11:3166349-3166371 CTGCGGAGGGCGAGCGGCCCAGG + Intronic
1077699952 11:4432040-4432062 CAGTGGAGGTGCAGAGGACCAGG + Intergenic
1078355438 11:10628731-10628753 CAGGTGAGGCCCAGCTGCCCGGG - Exonic
1079592165 11:22193589-22193611 CACCCGCGGCGCAGAGGCCCCGG + Intronic
1081699971 11:45146793-45146815 CGGCGGAGGCGGCGCGGCCTCGG - Intronic
1081831878 11:46121442-46121464 CGGCGGAGGTGCTGCGGCCCGGG - Intergenic
1083573023 11:63769752-63769774 CAGCCGGGGCGCAGCAGCCTGGG + Intergenic
1083863106 11:65436355-65436377 CAGCACAGGAGCAGAGGCCCAGG - Intergenic
1084169136 11:67392099-67392121 CAGCGGCGGTGCAGCAGCCGCGG + Intronic
1084620903 11:70270040-70270062 CATCGGAGGCGCTGAAGCCCAGG + Intergenic
1084621075 11:70270709-70270731 GAGCGGAGGAGGAGCGGGCCCGG - Exonic
1085205831 11:74731368-74731390 CGGCGGCGGCGCGGCGGCCGCGG + Intronic
1088172897 11:107018061-107018083 CGGCGGAGCTGCAGCGGCCGAGG + Exonic
1089499909 11:118925791-118925813 CGGCGGTGGTGCAGCGGCCCCGG + Intronic
1090245250 11:125211663-125211685 CAGCTCAGGCCCAGCTGCCCAGG + Intronic
1090293861 11:125569476-125569498 CAGTGCGGGCGCAGCGGCCCCGG + Exonic
1090639818 11:128720850-128720872 CAGAGAAGGCGCAGAGGGCCTGG - Intronic
1091434177 12:460387-460409 CAGCGGGGGCCGCGCGGCCCGGG - Exonic
1092002540 12:5044195-5044217 CAGAGGAGGCGATGAGGCCCGGG + Exonic
1092181833 12:6451597-6451619 CAGCGCAGGCGCAGCTGGCTGGG - Exonic
1092365385 12:7872862-7872884 CGGCGGGGGCGCAGCGGCCCGGG - Intronic
1092861515 12:12724045-12724067 CGGCGGAGGCGCGGCCGCCCGGG - Intergenic
1093234239 12:16586438-16586460 CAGCTGAGTCACAGAGGCCCTGG + Intronic
1094051670 12:26226984-26227006 GGGCGGAGGCGCGGTGGCCCCGG - Intronic
1096154520 12:49334574-49334596 CAGTGCGGGCGCTGCGGCCCTGG - Intronic
1096465778 12:51847308-51847330 CAGGGGAGGCCCCACGGCCCAGG + Intergenic
1096649415 12:53054521-53054543 CAGCGGAGGCGAGGCCGCCAGGG + Intronic
1097805231 12:63957978-63958000 CACCTGAGGCACAGCAGCCCTGG + Intronic
1101482162 12:105108168-105108190 CCCGGGAGGCCCAGCGGCCCCGG + Intronic
1101682902 12:106986905-106986927 CAGCGGCGCCGCAGCGGTCAGGG - Exonic
1103973633 12:124688018-124688040 CAGAGGAGGGGCGGCTGCCCGGG - Intergenic
1104376235 12:128267272-128267294 CAGCAGAGACGCAGCGGGCCCGG + Intergenic
1104746679 12:131215202-131215224 CAGAGGGGGCGCTGAGGCCCAGG + Intergenic
1104860938 12:131923217-131923239 CAGCCGAGGCGCAGGAGCCCAGG + Intergenic
1106157488 13:27171761-27171783 CAGCGGCGGCCCAGCGGGCTCGG - Exonic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1107959410 13:45545028-45545050 AAGAGGAGGAGCAGAGGCCCAGG - Intronic
1108615620 13:52129082-52129104 GCAGGGAGGCGCAGCGGCCCCGG - Intergenic
1112656135 13:101453979-101454001 CGCCGCAGTCGCAGCGGCCCCGG - Exonic
1113565598 13:111317869-111317891 AAGTGCAGGCGCAGAGGCCCGGG - Intronic
1113897916 13:113777495-113777517 GAGGGGAGGCGCGGTGGCCCCGG + Intronic
1114452945 14:22838344-22838366 CAGGGGAGGGGCGGCTGCCCTGG + Intronic
1119392297 14:74299204-74299226 CAGAGGAGGAGCAGCAGCTCTGG + Intronic
1119500883 14:75126729-75126751 CCCCGAAGGCGCCGCGGCCCAGG + Exonic
1120780038 14:88479070-88479092 CCGCAGAGGCCCAGCGGCCCTGG - Exonic
1120813043 14:88824670-88824692 CAGCGAAGGCCCAGCGCTCCAGG - Exonic
1121529411 14:94641732-94641754 CAGCGCAGGTTCAGCGGCCTGGG + Intergenic
1122582024 14:102777239-102777261 CAACGGCGGCGCCGCGGCGCGGG - Intergenic
1122984983 14:105207915-105207937 GTGCGGAGGTGCTGCGGCCCGGG - Intergenic
1123024922 14:105420005-105420027 CGGCGGCGGCGGAGGGGCCCGGG - Exonic
1124439318 15:29675160-29675182 CAGGGGAGGCTCGGCGACCCTGG - Intergenic
1124957249 15:34367393-34367415 CGACGGAGGCGCAGAAGCCCAGG - Intergenic
1126592556 15:50354777-50354799 CAGCGGCGGCGCGGGCGCCCAGG + Intronic
1128028645 15:64460772-64460794 CAGCGGCGGCTCTACGGCCCGGG + Intronic
1130224235 15:82045621-82045643 CAGCGGAGGGGGAGAGACCCTGG - Exonic
1131215112 15:90529927-90529949 CAGAGGAGCCGCCGCGGCCCCGG - Intronic
1131257633 15:90872261-90872283 CAGCGGGGGCACAGGGGCCTCGG - Intronic
1132087124 15:98917469-98917491 CAGCAGAGGAGCAGAGTCCCTGG - Intronic
1132326333 15:100973466-100973488 CAGCGGAGGCGCAGGGGCTTTGG - Intronic
1132388136 15:101416603-101416625 CATCAGAGGCCCAGAGGCCCAGG + Intronic
1132759508 16:1501922-1501944 CACCGTAGGCGCAGGGGCCGAGG + Intronic
1132889372 16:2196440-2196462 CAGCCGCGTCGCTGCGGCCCCGG - Exonic
1133088503 16:3384649-3384671 CATAGGAGGTGCAGAGGCCCAGG + Exonic
1133242824 16:4425853-4425875 CGGCGCAGGCGCAGAGTCCCCGG + Exonic
1134172081 16:11976762-11976784 CAGCGGCGGCGGCGCGGCGCAGG + Exonic
1136129489 16:28211281-28211303 CAGCGATGGCTCAGCAGCCCCGG + Intronic
1139583423 16:67886189-67886211 CAGTGGGGGCGCAGGGGCCATGG - Exonic
1141418851 16:83898980-83899002 CGGCGGGGGCGGAGCGGCTCTGG - Intergenic
1141665294 16:85462683-85462705 CGGCGGGGGCGCCGCGGCGCGGG + Intergenic
1141839713 16:86566991-86567013 CAGCGGAGACGCCGCGGCCTGGG - Intergenic
1142012060 16:87720532-87720554 CTGCGGAGACGCCGCGCCCCTGG + Intronic
1142178699 16:88656815-88656837 CAGGGAAGGCGCAGGAGCCCAGG + Intronic
1142249331 16:88983916-88983938 CAGCTGGGGTGCAGCAGCCCAGG - Intergenic
1142696074 17:1634649-1634671 CTGTGGAGGCGCAGAGGCTCTGG + Exonic
1142742609 17:1939937-1939959 CAGCAGAGACTCAGCTGCCCTGG - Intronic
1142836823 17:2593713-2593735 GAGCGGAGGAGCAGCGACACGGG + Intronic
1142855101 17:2724692-2724714 CGGCGGTGGCGCCGGGGCCCGGG + Intergenic
1144854101 17:18258555-18258577 AAGCGGAGGCCAAGCGGGCCGGG + Intronic
1146924038 17:36731907-36731929 CAGCGGAGGCGGGGCTGCGCTGG - Intergenic
1147134758 17:38428456-38428478 CAGCGGCGGCTCTGCGGCCGGGG - Exonic
1147134812 17:38428611-38428633 GAGCGGGGTCGCAGCGACCCTGG - Intronic
1148787159 17:50150995-50151017 GCGCGGCGGCGGAGCGGCCCGGG - Intergenic
1150382163 17:64729361-64729383 AAGCGGAGTGGCAGCTGCCCCGG - Intergenic
1150774103 17:68065490-68065512 AAGCGGAGTGGCAGCTGCCCCGG + Intergenic
1151763966 17:76122594-76122616 GAGCGGAGGCAGAGCGGCCCTGG + Intergenic
1151791441 17:76308153-76308175 GAGCGGAGGCGCAGATTCCCTGG - Intergenic
1152225405 17:79090467-79090489 CAGCGGCGGCGGAGCAGGCCCGG - Intronic
1152258848 17:79255737-79255759 CAGCTCAGGGGCAGCGTCCCTGG + Intronic
1152321217 17:79609778-79609800 CAGGGGAGGCTCCGCGTCCCGGG + Intergenic
1153993106 18:10417396-10417418 CAGCTCAGGTGCAGCGCCCCAGG - Intergenic
1154132898 18:11751665-11751687 CAGCGGAGGGGCTGCGGGCCCGG + Intronic
1154133028 18:11752088-11752110 CCGAGGTGGCGCAGCGCCCCGGG - Intronic
1157867223 18:51197293-51197315 CAGCGGCAGCTCCGCGGCCCTGG - Exonic
1159915221 18:74182466-74182488 GAGCTGAGGCTCAGCAGCCCAGG - Intergenic
1160357209 18:78238740-78238762 CTGGGGAGGCGAAGCAGCCCGGG + Intergenic
1160453160 18:78979226-78979248 CGCCGGCGGCGCAGAGGCCCAGG + Intergenic
1160680120 19:408533-408555 CCGCCCAGGCGCGGCGGCCCAGG + Intronic
1160701132 19:507924-507946 CAGCGCCGGCGCAGGGGCCCGGG + Intronic
1160766586 19:811277-811299 CAGCTGGGGCGCGGCGGCCGCGG + Exonic
1160967923 19:1754598-1754620 CAGCGCGGGCGCAGCGGCCGAGG + Exonic
1160991819 19:1863275-1863297 CCGCGGCGGCGCCGGGGCCCGGG + Exonic
1161029494 19:2051112-2051134 CGGCGGCGGCACTGCGGCCCCGG - Exonic
1161284688 19:3463267-3463289 CGGCAGAGGCGCGGGGGCCCGGG - Intronic
1162126770 19:8503645-8503667 CTGGGGAGGCCCAGAGGCCCAGG + Intergenic
1162316221 19:9939781-9939803 CAGAGGAGGCACAGCAGCCATGG - Intergenic
1163722119 19:18903297-18903319 CAGCGGCCTCCCAGCGGCCCTGG + Exonic
1163755399 19:19103692-19103714 CAGCTGAGGGGCAGAGGGCCCGG - Intronic
1165774039 19:38394762-38394784 GAGCGGAGGAGCGGCGGCGCTGG - Exonic
1166727456 19:45037601-45037623 CAGCGGAGGTGCCGGGGCCGTGG + Exonic
1166864068 19:45825675-45825697 CAGCAGAGCAGCAGCGGGCCGGG - Intronic
1167506377 19:49873154-49873176 CAGCATAGGCACAGGGGCCCGGG + Exonic
925164118 2:1705197-1705219 CAGGGGAGGCCCAGGGCCCCTGG - Intronic
925288298 2:2730133-2730155 GAGAGGAGGCACAGCTGCCCGGG + Intergenic
925971325 2:9108465-9108487 CAGCGGAGCCCCAGAGGCACTGG - Intergenic
926252016 2:11160078-11160100 CAGCTGAGGGGCAGCTGCCGGGG + Intronic
927336519 2:21930934-21930956 CAGGGGAGGCTCAGTGGACCAGG - Intergenic
927667572 2:25042763-25042785 CGCCGGCGGCGCAGAGGCCCGGG + Intronic
929536508 2:42787504-42787526 CAGGGGAGGTGCAGGGCCCCTGG + Intronic
932465926 2:71924069-71924091 CAGTTGAGGCGCAGCTGCTCTGG + Intergenic
932816471 2:74865972-74865994 CAGCTGAGGCTCAGAGGCTCAGG + Intronic
935654788 2:105412780-105412802 CAGCCGAGGAGCAGTGGCCAGGG + Intronic
936368624 2:111883986-111884008 CCCCGGAGGCGCAGGGGCCGAGG + Exonic
936399707 2:112155976-112155998 TCGCGGAGCCGCAGCTGCCCCGG - Intronic
938608257 2:132919344-132919366 AGGTGGAGGCGCAGAGGCCCTGG + Intronic
941929898 2:170929161-170929183 CTGCGGCGTCGCAGCGGCCCGGG + Exonic
942461674 2:176172416-176172438 CGGCGGAGGCGCAGGCGACCGGG + Exonic
944495852 2:200306838-200306860 CAGGGGAGGCGCCGCGGCGGTGG - Intronic
944495920 2:200307035-200307057 CGGCGGAGGCTGGGCGGCCCGGG - Intronic
946209886 2:218139033-218139055 CAGAGGAGGCTCAGGGGCACAGG + Intergenic
946325289 2:218981771-218981793 CAGCGGTGGCGGCGGGGCCCGGG + Exonic
946692512 2:222319942-222319964 CTGCGGAGACGCAGGAGCCCGGG - Intergenic
948725159 2:239929932-239929954 CAGCGGAGGAGCAGGGGCAGTGG - Intronic
948725184 2:239930034-239930056 CAGCGGAGGAGCAGGGGCAGTGG - Intronic
948725209 2:239930136-239930158 CAGCGGAGGAGCAGGGGCAGTGG - Intronic
948953899 2:241272639-241272661 CCGCGGAGGGGGAGGGGCCCGGG - Intronic
1171391559 20:24804707-24804729 CAGCACAGGCGGAGCAGCCCTGG + Intergenic
1171481361 20:25458110-25458132 CAGGGGAGCAGCAGAGGCCCTGG - Intronic
1171847736 20:30287678-30287700 CTGCGGCGAGGCAGCGGCCCTGG - Intergenic
1173166237 20:40688960-40688982 GAGCGAGGGCGCAGCGGGCCGGG + Exonic
1173494207 20:43507416-43507438 CAGCGGGGGCGCAGGGACCGCGG - Intergenic
1175259902 20:57667755-57667777 CTGCAGAGCCCCAGCGGCCCTGG + Intronic
1175330143 20:58158049-58158071 CAGAGCAGGCCCAGGGGCCCTGG - Intronic
1175446374 20:59023005-59023027 CAGAGGAAGGGCAGAGGCCCAGG + Intronic
1175549870 20:59810412-59810434 CAGCGGAGTAGCAGCATCCCAGG + Intronic
1175857958 20:62132955-62132977 CTGGGGAGGCCCAGGGGCCCAGG - Intronic
1175859706 20:62143634-62143656 GAGCGGCGGCGCCGCGGGCCCGG + Intergenic
1175927024 20:62476001-62476023 CTGCGGAGCCTCAGCGGCCCGGG - Intergenic
1175977194 20:62716963-62716985 CAGTGAAGGCGCAGTGGCCAAGG + Intronic
1176241946 20:64079465-64079487 TAGGGGAGGCGCTGCGCCCCCGG - Exonic
1176286761 21:5022708-5022730 GAGCGGAGGCGCCGCGGTCAGGG + Intronic
1176377594 21:6094174-6094196 CAGTGGCAACGCAGCGGCCCTGG + Intergenic
1176548594 21:8212224-8212246 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1176556488 21:8256432-8256454 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1176567525 21:8395259-8395281 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1176575427 21:8439474-8439496 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1178314904 21:31559393-31559415 CAGCGGAGGCGCGGCGGGCCGGG + Intronic
1179464226 21:41561107-41561129 CAGCAGTGGCTCAGGGGCCCAGG + Intergenic
1179745881 21:43444070-43444092 CAGTGGCAACGCAGCGGCCCTGG - Intergenic
1179826426 21:43968643-43968665 CAGCTGAGGCCCTGCGGGCCAGG - Intronic
1179870420 21:44240767-44240789 GAGCGGAGGCGCCGCGGTCAGGG - Intronic
1179876758 21:44272628-44272650 CAGCAGAGGGGCAGGGCCCCAGG + Intergenic
1180042836 21:45288621-45288643 CAGCGCAGGGGCGGCAGCCCCGG - Intergenic
1180614905 22:17120695-17120717 CGGCGGGGGCGCCGCGGCCGGGG - Exonic
1180673531 22:17571490-17571512 CAGCCGGGGCGCAGTGGCTCAGG + Intronic
1181038606 22:20181627-20181649 CAGTGGGGGTGCAGGGGCCCTGG - Intergenic
1181068360 22:20317144-20317166 CAGGGGAGCCTCAGGGGCCCTGG - Intronic
1181710739 22:24686096-24686118 CAGGGGAGGCCAGGCGGCCCGGG + Intergenic
1182278623 22:29205816-29205838 CAGCGGCGGCGCAGGGGGCGGGG + Intergenic
1182295771 22:29310712-29310734 CAGTGGAGGAGCAGCGGCACGGG - Exonic
1183654664 22:39177580-39177602 AAGTGGAGGTGCAGAGGCCCAGG - Intergenic
1184049183 22:41991676-41991698 CAGTGGAGGAGCAGTGCCCCAGG - Intronic
1184889466 22:47370975-47370997 CAGCCGAGGGGCATCTGCCCTGG + Intergenic
1185277384 22:49955708-49955730 CAGCGGAAGAGCAGGGACCCAGG + Intergenic
1185402671 22:50626933-50626955 CCGTGGAGGCGCAGCCCCCCTGG - Exonic
1203261532 22_KI270733v1_random:173607-173629 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
950625455 3:14243281-14243303 CAGGGGAGTCGCAGCAGCACCGG + Intergenic
952383024 3:32818823-32818845 CAGCAGCGGCGCAGCAGCTCGGG + Exonic
952956667 3:38562059-38562081 CAGCAGAAGCACAGGGGCCCTGG + Intronic
952967564 3:38630726-38630748 CAGCAGAGGCTCAGCAGACCTGG + Intronic
952970901 3:38649611-38649633 GGGCGCAGGCTCAGCGGCCCCGG + Exonic
953447396 3:42979708-42979730 CAGTCAACGCGCAGCGGCCCAGG + Intronic
954121980 3:48504770-48504792 CAGCGCTGGCGCAGTGGGCCAGG + Intronic
954715763 3:52525975-52525997 AAGTGGAGGGGCAGAGGCCCAGG + Intronic
954881036 3:53836208-53836230 GAGAGGAGGAGCAGCTGCCCAGG - Intronic
955870521 3:63433665-63433687 AAGGGGAGGCGCTGCAGCCCTGG - Intronic
956158727 3:66325640-66325662 CAGGGAAGGCCCAGCAGCCCAGG + Intronic
964851952 3:161104920-161104942 CAGCGGATGCGGCGCGGCCGCGG + Intronic
965439865 3:168699419-168699441 CAGGGCAGGCACAGGGGCCCTGG - Intergenic
967511895 3:190322328-190322350 CAGCGGCGGCGCAGCGAGCAGGG - Exonic
967941453 3:194769422-194769444 CAGGGGAAGCGCGGCCGCCCCGG + Intergenic
968160529 3:196423197-196423219 CGGCTGAGGCACAGCTGCCCTGG + Intronic
968258176 3:197297952-197297974 CCGCGGGGGTGCGGCGGCCCAGG - Intronic
968577749 4:1375876-1375898 CAGCGGTGGCCCTGAGGCCCAGG + Intronic
968582830 4:1402907-1402929 CCTCGGAGGCGGAGCGGCACGGG + Intergenic
968600985 4:1509208-1509230 CAGAGGAGGCCCGGAGGCCCAGG - Intergenic
968920801 4:3521357-3521379 CAGAGGAGGCGCTGGGGTCCGGG - Intronic
969426801 4:7129168-7129190 CAGCGGCAGCCCAGCGGCACTGG - Intergenic
969620741 4:8277542-8277564 CAGAGGAGGCGCTGCTGGCCTGG + Intronic
973759068 4:54100581-54100603 CAGCGGGGGCGCAGGGGCCGGGG + Exonic
975041057 4:69744287-69744309 CAGCGGAGGCGCAGCGGCCCTGG + Intronic
975621386 4:76300161-76300183 CAGGGCAGGGGCAGCGGGCCCGG - Intronic
977257550 4:94757927-94757949 CGGCGGCGGCGGAGCGGCCGCGG + Intergenic
979674815 4:123398796-123398818 GAGCGGCGGCGCGGTGGCCCAGG + Intronic
982630182 4:157821879-157821901 CAGAGCAGGCGCTGAGGCCCAGG - Intergenic
985541910 5:491359-491381 CAGCGGTGGCCGAGCGGCTCCGG + Intronic
985577459 5:680143-680165 CAGCAGGGGCGCAGGGGCCGCGG - Intronic
985592391 5:772239-772261 CAGCAGGGGCGCAGGGGCCGCGG - Intergenic
985630059 5:1009393-1009415 CAGCGAAGGCGCAGCGCCCGCGG + Intronic
989178989 5:38557144-38557166 GAGCGGCGGCGCCTCGGCCCTGG - Intronic
990041567 5:51383455-51383477 GAGCGGAGGCGCTGCGGCGGCGG - Exonic
992067403 5:73120508-73120530 CTGCGCGGGCGCGGCGGCCCGGG - Exonic
992530255 5:77645770-77645792 CAGCCGAGGCGGAGCGGGCCGGG - Intergenic
996948101 5:129094489-129094511 CTGCGGGAACGCAGCGGCCCGGG + Intergenic
997201128 5:132010939-132010961 CAGTGGAGACACAGCAGCCCTGG + Intronic
997594043 5:135094648-135094670 CATGGGAGGGGCAGCGGACCTGG - Intronic
999375041 5:151080937-151080959 CAGGGACGGGGCAGCGGCCCGGG + Intronic
1002160721 5:177312526-177312548 CGGCGGAGGGGCGGCGGACCCGG + Intronic
1003136636 6:3439388-3439410 CACCGGAGCCACTGCGGCCCTGG + Intronic
1003689888 6:8343240-8343262 CAGAGCAGGCACAGCTGCCCAGG + Intergenic
1005956203 6:30665209-30665231 CTGGGGAGGAGCAGCGGCGCTGG - Exonic
1007828164 6:44617350-44617372 CACCAAAGGCGCAGGGGCCCTGG - Intergenic
1010043985 6:71420121-71420143 CACCGGCCGCGCTGCGGCCCCGG + Intergenic
1010703301 6:79077766-79077788 CGGCGGCGGGGCCGCGGCCCGGG - Intronic
1012410120 6:98947627-98947649 AAGCGGAGGCGCGGGGGCGCGGG + Intronic
1014098213 6:117482696-117482718 CAGAGGAGGCGGCCCGGCCCGGG + Exonic
1015315044 6:131808008-131808030 CAGCGGGGCCGGAGCGGCCGGGG + Exonic
1018469858 6:164085642-164085664 GAGCGAAGGCTCCGCGGCCCTGG - Intergenic
1019145870 6:169975320-169975342 CAGCTGAGGGGCAGCAGCCAAGG + Intergenic
1019506747 7:1395217-1395239 CAGGGCAGGCACAGCAGCCCAGG - Intergenic
1019545085 7:1570235-1570257 CAGCAGAGGGGCTGAGGCCCGGG - Intronic
1019738544 7:2661902-2661924 CAGTGGAGACGCAGGGGCTCTGG + Exonic
1022559842 7:31336632-31336654 CAGTGTGGGCGCCGCGGCCCGGG + Intergenic
1023848631 7:44138462-44138484 CAGCGGGTGGGCAGCAGCCCTGG - Intergenic
1026232339 7:68496220-68496242 CAGAAGAGGAGCAGCAGCCCAGG + Intergenic
1027683135 7:81245519-81245541 CAGCGGTGCCACAGCAGCCCTGG - Intergenic
1031791943 7:126117960-126117982 CATCAGAGGCCCAGAGGCCCAGG + Intergenic
1032018117 7:128392578-128392600 TGGCTGAGGGGCAGCGGCCCGGG + Exonic
1033681703 7:143601510-143601532 CAGAGGCGGAGCAGCGGCTCAGG - Intergenic
1033703188 7:143860303-143860325 CAGAGGCGGAGCAGCGGCTCAGG + Exonic
1034201470 7:149285477-149285499 TACCGGAGGCGCAGCCGCCTCGG - Intronic
1034306615 7:150048895-150048917 CAGAGGACGCCCAGAGGCCCAGG + Intergenic
1034800230 7:154051748-154051770 CAGAGGACGCCCAGAGGCCCAGG - Intronic
1034954287 7:155324705-155324727 CAGCAGCGGCGCAGATGCCCTGG - Intergenic
1035266030 7:157690775-157690797 CAGCGGCTGCGCGGCGGCACGGG + Intronic
1035751709 8:2001435-2001457 CAGCGCGGGCGCCGCGTCCCCGG + Exonic
1036786667 8:11692625-11692647 CGGCTGAGGCGCAGAGGCCGCGG - Intronic
1037529066 8:19756876-19756898 CCCCGGGAGCGCAGCGGCCCCGG + Intronic
1037886839 8:22599879-22599901 CGAGGGAGGCGCAGCGGCGCGGG - Intronic
1040038842 8:42896768-42896790 CGGCGGCGGCGCGGCGGCGCGGG + Intronic
1041108817 8:54466994-54467016 CAGAAGAGGCCCCGCGGCCCGGG + Intergenic
1048198913 8:132355305-132355327 GAGGGGAGGCACAGAGGCCCTGG - Intronic
1049416694 8:142498698-142498720 CAGGGGAGGTGCAGCGGCCCTGG - Intronic
1054159186 9:61661857-61661879 CACCGGCGAGGCAGCGGCCCCGG + Intronic
1054478960 9:65592862-65592884 CACCGGCGAGGCAGCGGCCCCGG + Intergenic
1054775530 9:69121222-69121244 CAGCGGTGGGGCAGGGGCCGCGG - Intergenic
1055447099 9:76394376-76394398 CAGCGGAGACGCAGCTCCTCAGG - Exonic
1056233176 9:84567470-84567492 CAGCAGAGGTGCAGGGGCCGAGG - Intergenic
1056732771 9:89180091-89180113 CAGAGGAGCCGCGGCGTCCCCGG + Intergenic
1058053328 9:100427368-100427390 CAGCGGCGGCGCGGCAGCCGCGG - Intronic
1058866653 9:109167177-109167199 CAGCGGGGGCGCCGCGGGCGCGG + Exonic
1061208394 9:129177212-129177234 GGGCGGAGGCGCAGCAGTCCTGG + Exonic
1061624724 9:131834995-131835017 CATCGCAGGCCCAGCGGCCTCGG + Intergenic
1061805137 9:133133538-133133560 CAGCCGAGGCGCTGGGGCCTGGG + Intronic
1061876730 9:133547777-133547799 CAGGGGAGGGGCAGGGGCCACGG - Intronic
1061939878 9:133878217-133878239 CAGGGGAGGCTCAGAGGCCAGGG + Intronic
1062320200 9:135986926-135986948 CAGGGGAGGGGCAGGGGCCCAGG - Intergenic
1203469878 Un_GL000220v1:111676-111698 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1203477699 Un_GL000220v1:155648-155670 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1187173072 X:16870333-16870355 GAGCGCAGGCGCATCCGCCCTGG + Intronic
1190108296 X:47574104-47574126 CAGCCTCGGCCCAGCGGCCCGGG - Exonic
1190333856 X:49251178-49251200 CAGCGGGGGAACAGGGGCCCTGG + Exonic
1192988695 X:76428095-76428117 CCTCAGAGGCGCAGAGGCCCTGG - Exonic
1195668348 X:107449912-107449934 CAGCGGCGGCGCAGCGGCGGCGG - Intergenic
1198312067 X:135433749-135433771 GAGCGGGGCCGAAGCGGCCCTGG + Intergenic
1199327127 X:146512812-146512834 CAGTGGAGGCCCAGAGGCCTAGG + Intergenic
1199767067 X:150948959-150948981 CACCTGAGGCGCCGTGGCCCTGG + Intergenic
1200107609 X:153723856-153723878 CACCGGAGGCGAAGCGGCCCCGG - Exonic
1200216560 X:154370644-154370666 CAGCCGGGGCGCAGCGGGCGGGG + Intronic