ID: 975048649

View in Genome Browser
Species Human (GRCh38)
Location 4:69832044-69832066
Sequence CTAATTTGACCCAGAGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 4, 3: 5, 4: 158}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975048649_975048659 29 Left 975048649 4:69832044-69832066 CCAGCCTCTCTGGGTCAAATTAG 0: 1
1: 0
2: 4
3: 5
4: 158
Right 975048659 4:69832096-69832118 CTCTTCTGTCCTTACGGGACAGG 0: 1
1: 1
2: 5
3: 13
4: 97
975048649_975048654 -5 Left 975048649 4:69832044-69832066 CCAGCCTCTCTGGGTCAAATTAG 0: 1
1: 0
2: 4
3: 5
4: 158
Right 975048654 4:69832062-69832084 ATTAGTGGTTATACCTCGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 36
975048649_975048656 23 Left 975048649 4:69832044-69832066 CCAGCCTCTCTGGGTCAAATTAG 0: 1
1: 0
2: 4
3: 5
4: 158
Right 975048656 4:69832090-69832112 AAGCTCCTCTTCTGTCCTTACGG No data
975048649_975048657 24 Left 975048649 4:69832044-69832066 CCAGCCTCTCTGGGTCAAATTAG 0: 1
1: 0
2: 4
3: 5
4: 158
Right 975048657 4:69832091-69832113 AGCTCCTCTTCTGTCCTTACGGG 0: 1
1: 0
2: 5
3: 24
4: 202
975048649_975048653 -8 Left 975048649 4:69832044-69832066 CCAGCCTCTCTGGGTCAAATTAG 0: 1
1: 0
2: 4
3: 5
4: 158
Right 975048653 4:69832059-69832081 CAAATTAGTGGTTATACCTCGGG 0: 1
1: 0
2: 0
3: 8
4: 69
975048649_975048652 -9 Left 975048649 4:69832044-69832066 CCAGCCTCTCTGGGTCAAATTAG 0: 1
1: 0
2: 4
3: 5
4: 158
Right 975048652 4:69832058-69832080 TCAAATTAGTGGTTATACCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975048649 Original CRISPR CTAATTTGACCCAGAGAGGC TGG (reversed) Intronic
900288736 1:1914828-1914850 GTAATTAGACCCAGACAGGGAGG + Exonic
901987222 1:13085609-13085631 GTAATCTGACCCAGAGAGGCTGG + Intergenic
901994590 1:13141158-13141180 GTAATCTGACCCAGAGAGGCTGG - Intergenic
902385066 1:16071792-16071814 CTAAGGTCACCCTGAGAGGCTGG - Intronic
902464058 1:16603821-16603843 CTAATTTGACCTAAAGTGCCAGG + Intronic
903157041 1:21452854-21452876 CTAATTTGACCTAAAGTGCCAGG - Intronic
904376337 1:30084713-30084735 CTAAATTGAGACAGAGAGCCTGG + Intergenic
905811172 1:40914346-40914368 ATCACTTGAACCAGAGAGGCAGG + Intergenic
905908653 1:41638878-41638900 CTGTTATGACCCAGTGAGGCTGG - Intronic
908736552 1:67282895-67282917 TTAATTTGACCTAAAAAGGCAGG + Intergenic
913992571 1:143628219-143628241 CTAATTTGACCTAAAGTGCCAGG + Intergenic
916632485 1:166631324-166631346 CTAACCTGACCCAGAGAGAGAGG + Intergenic
918907342 1:190514243-190514265 CTACTTTGACCCAGAGTTGTTGG + Intergenic
920874980 1:209826388-209826410 CTAATTAGATTCGGAGAGGCTGG - Intergenic
923577177 1:235169956-235169978 CTAATTTATAACAGAGAGGCCGG - Intronic
924413638 1:243833978-243834000 CTAATTTGAGCCACTGTGGCTGG + Intronic
1065648638 10:27864232-27864254 CTAAGTTGAGCCAGAGACGTGGG - Intronic
1067134533 10:43596194-43596216 ATAATCCGACCCAGAGAGGTAGG - Intergenic
1070041476 10:72784752-72784774 CTTACTTCAGCCAGAGAGGCAGG - Intronic
1070958616 10:80482819-80482841 ATCACTTGAACCAGAGAGGCGGG - Intronic
1071681201 10:87707290-87707312 CTAATTTGACACTGAAAGGCCGG + Intronic
1071726895 10:88207877-88207899 CTAATGTGGCCCTGGGAGGCTGG - Intergenic
1073461871 10:103670481-103670503 CTGATTGAACCCAGGGAGGCAGG - Intronic
1074038539 10:109765164-109765186 ATATTTTGACCCAGACAGGTTGG - Intergenic
1075559375 10:123457226-123457248 CCAGCTTGCCCCAGAGAGGCAGG - Intergenic
1077463773 11:2723810-2723832 CAAATGGGACACAGAGAGGCTGG - Intronic
1078000862 11:7494547-7494569 GCACTTTGACCCAGACAGGCTGG + Intronic
1078436629 11:11330868-11330890 CCAAACTCACCCAGAGAGGCAGG - Intronic
1080625805 11:34029671-34029693 CTACAATGACCCAGTGAGGCGGG - Intergenic
1084564485 11:69921394-69921416 CTGGGGTGACCCAGAGAGGCTGG + Intergenic
1086642787 11:89180321-89180343 TTAACTTGACCCAGAAAGGTTGG + Intronic
1090287466 11:125512257-125512279 TTAATCCGACCCAGAGGGGCTGG + Intergenic
1091262554 11:134245831-134245853 CTCATGTTCCCCAGAGAGGCTGG - Exonic
1092161880 12:6319557-6319579 CTGATGTGCCCCAGAGAGGGAGG + Intronic
1092629669 12:10364114-10364136 CTAATCCAACCCAGAGTGGCTGG + Intergenic
1095269021 12:40194506-40194528 CTGATTTGGTCCAGAAAGGCGGG + Intergenic
1097084203 12:56455210-56455232 CTATTTTGTCCCAGAGCTGCAGG - Intronic
1098468288 12:70814200-70814222 CTCATTTGACCTAGAGGGGCAGG + Intronic
1100072930 12:90743440-90743462 CTAATTAGAAACACAGAGGCCGG + Intergenic
1101156468 12:101932528-101932550 CTAATTTGATTCAGAGCGCCAGG + Intronic
1101587572 12:106098484-106098506 CTACTTTGTCCCAGAAAGCCAGG + Intronic
1102568721 12:113814404-113814426 CTGCTTGAACCCAGAGAGGCAGG + Intergenic
1110435272 13:75471784-75471806 CTAATTTGAGGCAGGTAGGCAGG - Intronic
1110972303 13:81780472-81780494 ATAATGTGACACATAGAGGCTGG + Intergenic
1112366623 13:98761023-98761045 GTAGTCTGACCCAGAGAGGTTGG + Intergenic
1112409791 13:99153073-99153095 CTGATTTCACCCAGAATGGCAGG - Intergenic
1112660263 13:101499857-101499879 CTAATTTGCCCCTGAGATGGAGG + Intronic
1114573629 14:23693425-23693447 ATAGTTCGACCCAGAGGGGCTGG + Intergenic
1115097098 14:29650203-29650225 CTAATCTGACCCAGAGGGGCTGG - Intronic
1117626647 14:57646790-57646812 TTAATGTGACCCAGAGATTCTGG + Intronic
1118907764 14:70034924-70034946 CTGTTTTGAGCCAGAGAGGTTGG - Intergenic
1119793137 14:77371586-77371608 ATAATTGGATTCAGAGAGGCAGG + Intronic
1119877281 14:78071515-78071537 TTAATTTGACCAAGACATGCTGG - Intergenic
1120763032 14:88303145-88303167 CTGATGTGATCAAGAGAGGCAGG + Intronic
1121154848 14:91673368-91673390 CCAATTTTACTCAGAGAGACAGG + Intronic
1126707151 15:51416190-51416212 CTGGTTTGGCCCAGAAAGGCAGG + Intergenic
1127808894 15:62546102-62546124 CTGCTTTGACACAGTGAGGCTGG + Intronic
1128262621 15:66243168-66243190 CCCATTTGCCCCTGAGAGGCCGG + Intronic
1131536222 15:93240105-93240127 CAAATCTGACCCATTGAGGCGGG + Intergenic
1132559882 16:588867-588889 GTAACTTCACCGAGAGAGGCAGG + Intergenic
1134314993 16:13110489-13110511 CTCATTTGTCCCAGAGAAACAGG - Intronic
1135707681 16:24688798-24688820 CTGATTTGACCCAGTGACTCTGG - Intergenic
1137539413 16:49351796-49351818 CTAAATCGGCCCAGTGAGGCTGG + Intergenic
1139230262 16:65276562-65276584 CTGATTTGACCAATAAAGGCTGG + Intergenic
1141637787 16:85323850-85323872 CTAGGTTGACACAGAGTGGCTGG + Intergenic
1143840439 17:9727570-9727592 CTAATATGACCTAGAAAAGCAGG + Intronic
1144672951 17:17143279-17143301 CTTCTGTGACCCAGAGAAGCTGG + Intronic
1149432694 17:56607036-56607058 CTATTTGTACCCAGAGAAGCTGG + Intergenic
1152259572 17:79259767-79259789 CTACTGTGACCCTGAGATGCGGG - Intronic
1153028138 18:689614-689636 TAAATTTCTCCCAGAGAGGCTGG + Intronic
1153071092 18:1105549-1105571 ATAAAATGACCCAGAGAGTCTGG + Intergenic
1155421085 18:25657064-25657086 CAAATTTGACCAATATAGGCTGG - Intergenic
1155882924 18:31172346-31172368 CTAATTTCACCCTTAGAGTCTGG + Intergenic
1157335067 18:46732046-46732068 CTCATTTGTCCAAGAGGGGCAGG + Intronic
1157663432 18:49465779-49465801 CTAATTTGTCCCAGACAGGAAGG - Intergenic
1161460607 19:4394723-4394745 CTAAATTGATCAACAGAGGCCGG - Intronic
1161520146 19:4719400-4719422 CCAATGTCACCCAGAGAGGAAGG + Intronic
1163192879 19:15692042-15692064 ATAGCTTGAACCAGAGAGGCAGG - Intronic
1164011447 19:21206353-21206375 CTAATCCAACCCAGAGTGGCTGG - Intergenic
1202679717 1_KI270711v1_random:41261-41283 CTAATTTGACCTAAAGTGCCAGG + Intergenic
925832134 2:7906221-7906243 CTAATTTGAAGCCTAGAGGCTGG - Intergenic
926935383 2:18082579-18082601 CCCATTTGAACCAAAGAGGCAGG + Intronic
927824497 2:26298707-26298729 CTAATCCAACCCAGAGTGGCTGG + Intergenic
928857507 2:35817495-35817517 CTGATTTGACTAAGAAAGGCTGG - Intergenic
929373258 2:41252718-41252740 ATATTTTGTCCCAGAGAGGGAGG - Intergenic
930839926 2:55834692-55834714 TTAATTTGTCCCAGAGATTCTGG + Intergenic
932002090 2:67894303-67894325 CTTACTTGACCCAGAGGGGCAGG + Intergenic
933878237 2:86641992-86642014 ATCATTTGAACCAGGGAGGCAGG - Intronic
935762505 2:106334407-106334429 CCACTTTGACCCAGAAAGGAGGG + Intergenic
942168733 2:173268353-173268375 CCTATCTGACCCAGATAGGCTGG - Intergenic
942936450 2:181562263-181562285 TTGGTTTGGCCCAGAGAGGCGGG - Intronic
945301097 2:208217160-208217182 CTGATTTGACCAATAAAGGCTGG + Intergenic
1171395715 20:24831719-24831741 TTGGTTTGACCCAAAGAGGCAGG - Intergenic
1178318242 21:31585117-31585139 CTCATTTGAACCTGGGAGGCAGG - Intergenic
1178784143 21:35636869-35636891 CTAAGATGACCCAGAGAGTAAGG + Intronic
1180885609 22:19241114-19241136 CTTCTGTGACCCAGAGAGCCTGG - Intronic
1181837382 22:25622051-25622073 CTATTTTGACAAAGAGAGGAGGG - Intronic
1182109298 22:27711455-27711477 CTAACTAGACCTAGAGAGACAGG + Intergenic
1183666592 22:39249663-39249685 CTCATTTAACCCAGTGAGGTAGG - Intergenic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
951907761 3:27721454-27721476 GGAATTTGAGCCACAGAGGCCGG + Exonic
963786642 3:149541621-149541643 CTACTTTGACCAAGAGAGTGTGG + Intronic
965671896 3:171156311-171156333 CTGATTTAAACCAGGGAGGCTGG + Intronic
969653703 4:8483713-8483735 CTGATTTGACCAATAAAGGCTGG + Intronic
971481933 4:27122770-27122792 CTGGTTTGGTCCAGAGAGGCAGG - Intergenic
972289285 4:37676658-37676680 GCAATTTGGCCCACAGAGGCTGG + Intronic
974977326 4:68906774-68906796 CTAATCCAACACAGAGAGGCTGG - Intergenic
975048649 4:69832044-69832066 CTAATTTGACCCAGAGAGGCTGG - Intronic
976768179 4:88620568-88620590 GTAACTTGGACCAGAGAGGCAGG - Intronic
978204356 4:106062597-106062619 CCCATTTGACCCACAGAGGTTGG - Intronic
978671865 4:111257629-111257651 CTGATTTGTCCAAGAAAGGCAGG - Intergenic
980285293 4:130771982-130772004 CTAATTTGACTAATAAAGGCTGG - Intergenic
984036520 4:174674882-174674904 CTATTTTGGGCCAGAGAGACAGG - Intronic
985884312 5:2664792-2664814 CTAATTTGAGATAGAGAGGGAGG + Intergenic
987301774 5:16603862-16603884 CTCTTTTGACCCAGGGTGGCGGG - Intronic
988138607 5:27206741-27206763 CTAATTTGATTCAGAAAAGCAGG - Intergenic
990071483 5:51788317-51788339 TTAATGTGACCCAGAGATTCTGG + Intergenic
991345379 5:65660451-65660473 GTAATTGGACCCCGAAAGGCAGG - Intronic
991424765 5:66479094-66479116 TTAGTTTGGTCCAGAGAGGCAGG - Intergenic
991515753 5:67433429-67433451 CAAATATAACCAAGAGAGGCTGG + Intergenic
992465081 5:76996323-76996345 CTACTTTGACCCAGAGTGGAGGG - Intergenic
994775997 5:104036017-104036039 CTGATTTGACTCATAAAGGCTGG - Intergenic
994778568 5:104064945-104064967 CTGATTTGACTCATAAAGGCTGG + Intergenic
995271518 5:110225051-110225073 ATAATTATATCCAGAGAGGCTGG + Intergenic
995865077 5:116681759-116681781 TTAATATGACCCAAAGGGGCTGG + Intergenic
1001356008 5:171023076-171023098 CTAGTGTGATCCAGAGAGGAAGG - Intronic
1005154773 6:22792216-22792238 GTCACTTGAACCAGAGAGGCAGG - Intergenic
1005449209 6:25956636-25956658 CTGGTTTGGTCCAGAGAGGCGGG + Intergenic
1006293897 6:33161373-33161395 TTAATGTGACCCTGAGAGGGAGG + Intergenic
1006729495 6:36225496-36225518 CTAGTTTGACCCACTCAGGCTGG - Intronic
1008389606 6:50934616-50934638 CCTATTTGACCAAAAGAGGCAGG + Intergenic
1008746745 6:54679993-54680015 ATAATTTGACCTAGAGAGTTAGG - Intergenic
1011300404 6:85867020-85867042 ATAGTTTGACCCACAGGGGCTGG - Intergenic
1012880474 6:104781890-104781912 CTTTGTTGACCCAGAGAGGGAGG - Intronic
1021422472 7:20461270-20461292 CTGATGTGACCCAAAGAGGAGGG + Intergenic
1022831584 7:34072748-34072770 CTAATATGACCAAGAGTGGTCGG - Intronic
1024498047 7:50070264-50070286 CTAATCCAACCCAGAGTGGCTGG - Intronic
1026360211 7:69597224-69597246 GCTATTTTACCCAGAGAGGCTGG + Intergenic
1031193268 7:118582297-118582319 CTGATCTGACCCAGAGATTCAGG - Intergenic
1031364447 7:120886936-120886958 CTGATTTGACTCATAAAGGCTGG + Intergenic
1031464004 7:122085645-122085667 TGAATTTGATCCTGAGAGGCTGG + Intronic
1039351700 8:36770584-36770606 TTAATTTGGTCCAGAAAGGCAGG + Intergenic
1039510918 8:38091237-38091259 CTTATTCAACCCAGAGTGGCTGG - Intergenic
1041048414 8:53909102-53909124 CTGATTTGACACAGAGAAGTTGG + Intronic
1041220832 8:55649177-55649199 CCAAGCTGACCCAGAAAGGCTGG + Intergenic
1042144006 8:65708603-65708625 CTAATCTATTCCAGAGAGGCAGG + Intronic
1042189242 8:66168637-66168659 TTAAATTGACCCAGAAAGACAGG + Intronic
1045636257 8:104194758-104194780 CTACTCTGACCTAGAGAGACTGG + Intronic
1047358388 8:124144793-124144815 CTAAATTCACCCAGATGGGCAGG + Intergenic
1047547099 8:125828885-125828907 AAAATTAGACCGAGAGAGGCTGG - Intergenic
1055882120 9:81013981-81014003 CTAATTTGACTAATAAAGGCTGG - Intergenic
1058535366 9:105953988-105954010 CTAATTTGAATAAGAGAGGTAGG - Intergenic
1059010917 9:110458496-110458518 TTAATATGTCCAAGAGAGGCAGG + Exonic
1059984383 9:119807844-119807866 CTATTTTGGCCCCGGGAGGCAGG - Intergenic
1060149670 9:121280258-121280280 CCAAGTTGTCCCTGAGAGGCGGG + Intronic
1060947244 9:127577220-127577242 ATCACTTGAACCAGAGAGGCAGG + Intronic
1203791700 EBV:155069-155091 CTAATTTTGCCCAGAGAGGCTGG + Intergenic
1185953045 X:4457694-4457716 CTAAATTTACCCAGTGAGGACGG - Intergenic
1189304226 X:39974515-39974537 CTGTTGTCACCCAGAGAGGCAGG - Intergenic
1190342472 X:49308571-49308593 CTAATCCAACCCAGAGTGGCTGG + Intronic
1191929062 X:66348921-66348943 TTAATTTGTCCCAGAGATTCTGG - Intergenic
1195566551 X:106345801-106345823 CTGATTTGGTCCAGAAAGGCAGG + Intergenic
1198141912 X:133812869-133812891 CTACCTAGACCCAGAGAGTCTGG - Intronic
1199036676 X:143059180-143059202 CTGATTTAACCCAGAGATGTTGG + Intergenic
1200293491 X:154894116-154894138 CTGATTTGGTCCAGAAAGGCGGG - Intronic
1201357353 Y:13111843-13111865 CTAATCCAACCCAGAGTGGCTGG + Intergenic
1201755904 Y:17484936-17484958 CTAATCCAACCCAGAGTGGCTGG - Intergenic
1201845648 Y:18421049-18421071 CTAATCCAACCCAGAGTGGCTGG + Intergenic