ID: 975048867

View in Genome Browser
Species Human (GRCh38)
Location 4:69834099-69834121
Sequence CTGGATAATTACCAATATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975048867 Original CRISPR CTGGATAATTACCAATATGT AGG (reversed) Intronic
904455675 1:30646733-30646755 GTGGATTAATGCCAATATGTAGG - Intergenic
907903809 1:58766042-58766064 CTGTATAATTTCAAATATTTGGG - Intergenic
908428678 1:64034624-64034646 CTAGATAATGACCATTATGGTGG + Intronic
911453402 1:98094421-98094443 CTGAATAATTAGAAATGTGTAGG + Intergenic
918781344 1:188703921-188703943 CTGAATAATTAACACCATGTAGG + Intergenic
919963780 1:202500109-202500131 CTGGATAAATACCAAGTGGTGGG - Intronic
921451757 1:215316818-215316840 CTGGATATTAACCAACATGCAGG - Intergenic
1065892139 10:30130538-30130560 CTTGACAATTACCAAGATGAGGG - Intergenic
1066205480 10:33185268-33185290 CTGGATAATTCCAAATATCTGGG - Intronic
1068471342 10:57468021-57468043 CTGGTTAATTAACGATATGTAGG - Intergenic
1069271720 10:66536644-66536666 CTGCATAAGTACCAAAATTTAGG - Intronic
1077828118 11:5832212-5832234 TTGGGTAAATACCTATATGTTGG - Intronic
1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG + Intronic
1080171875 11:29313653-29313675 CTGGATAATTTCTAAGATCTGGG + Intergenic
1080288942 11:30649228-30649250 CTGGATAATTGCCACAATGAAGG - Intergenic
1080894459 11:36437671-36437693 CTGCATAACTAGCAATTTGTAGG + Intronic
1081283770 11:41244078-41244100 ATGGATAATTTCCACTATGAAGG + Intronic
1084307833 11:68298423-68298445 TTTGAGAATTACCAACATGTAGG + Intergenic
1087675148 11:101153055-101153077 TTGGATATATACCAATAAGTGGG + Intergenic
1088691091 11:112328847-112328869 CTGGATAAATAACAAAATGAAGG - Intergenic
1089905387 11:122032816-122032838 ATGGATAATAACCTATATGGTGG - Intergenic
1090153635 11:124412871-124412893 CAGGATCACTACAAATATGTGGG + Intergenic
1094225809 12:28044509-28044531 TAGGATAAATACCAATAAGTGGG - Intergenic
1094768144 12:33621128-33621150 CTGGAAAGTTGGCAATATGTGGG - Intergenic
1095883043 12:47159245-47159267 CTGGATAAATACCAAGTAGTGGG + Intronic
1097002493 12:55889301-55889323 CTGCATTATTTCCAATAAGTCGG - Intergenic
1098786702 12:74767475-74767497 TTGGATATTTACCAAAAAGTGGG - Intergenic
1099306559 12:80964024-80964046 CTAGATATTTAAGAATATGTTGG + Intronic
1104623535 12:130336158-130336180 ATGAATAATAAGCAATATGTAGG + Intergenic
1104819955 12:131671251-131671273 CTGGATAAATACCCAGAAGTGGG - Intergenic
1104996204 12:132659068-132659090 ATGGATAATTGCCATTTTGTAGG - Intronic
1109395115 13:61746703-61746725 TTGGATTTTTACCCATATGTAGG - Intergenic
1109635907 13:65115816-65115838 CTTGATAATTACTAGTATGTTGG - Intergenic
1112469910 13:99678627-99678649 GTGCATAATTAACAATTTGTTGG - Intronic
1115987104 14:39113182-39113204 CTTGATTATCACCAAAATGTTGG + Intergenic
1116526570 14:45913218-45913240 CTGGATAAATACCCATAAGTGGG + Intergenic
1117892908 14:60445963-60445985 CTGGATAAATAACAAAATGAAGG + Intronic
1117898460 14:60510342-60510364 CTGGCTTATTAGCAATGTGTCGG + Intronic
1118700379 14:68427054-68427076 CTGCAGAATTAGCACTATGTGGG - Intronic
1120419439 14:84264842-84264864 CTGCAGAATTACCATTTTGTAGG + Intergenic
1121145829 14:91581482-91581504 CTGGATCATGACGAATAAGTAGG + Intronic
1127397654 15:58555593-58555615 CAGGATAATTAACACTGTGTCGG + Intronic
1127445317 15:59056432-59056454 CAAGATGATTCCCAATATGTGGG - Intronic
1130423416 15:83771774-83771796 TTGGATAAATACCAAGAAGTTGG + Intronic
1131015647 15:89055687-89055709 CTGGATGTCTACCAATATGGGGG + Intergenic
1131469752 15:92685946-92685968 CTATATAATTACCAATTTGCAGG + Intronic
1131949513 15:97665872-97665894 CTGGAGATTTACCACTATGAAGG - Intergenic
1146107407 17:30052507-30052529 TTGGATACTTACAAATCTGTGGG + Intronic
1146493862 17:33303157-33303179 TCTAATAATTACCAATATGTTGG - Intronic
1148988985 17:51648912-51648934 CTGGCTCATTACCAATCTATGGG + Intronic
1150891849 17:69160897-69160919 CTGGATAAATACCCAGAAGTGGG - Intronic
1151504532 17:74518435-74518457 CTGGATAAATACCCAGAAGTGGG - Intergenic
1153031349 18:716005-716027 TTGGATAATTACCTATGAGTAGG - Intergenic
1154382682 18:13866927-13866949 CTGGATAATTAGAAAGATGGTGG - Intergenic
1155417887 18:25620493-25620515 CTGGATAAATACCCAAAAGTGGG + Intergenic
1156368668 18:36453034-36453056 CTGGATAAATACCCAGAAGTTGG + Intronic
1156723972 18:40105250-40105272 CAAGAAATTTACCAATATGTAGG + Intergenic
1167295047 19:48645038-48645060 CTGGATTATTATTAATGTGTTGG + Intronic
925817836 2:7770541-7770563 CTGCAGAGTTACCAATATTTAGG - Intergenic
927318195 2:21710583-21710605 CAGGAAACTTACCAATATGGTGG + Intergenic
928654249 2:33433489-33433511 CTAGATAATGACCAAATTGTGGG - Intergenic
928673179 2:33623194-33623216 TTAGATAATTACCTATAAGTAGG + Intergenic
928695444 2:33844788-33844810 CTGGATAATTTCCACAATGTTGG + Intergenic
931870355 2:66451009-66451031 GTGGGTTATTACCCATATGTGGG + Intronic
932098622 2:68875406-68875428 CTGGCTAATAACCACCATGTTGG + Intergenic
933408706 2:81897011-81897033 CAGGATAAATACCAGGATGTAGG - Intergenic
934936545 2:98469871-98469893 CTGGCTCAACACCAATATGTGGG - Intronic
938917620 2:135958738-135958760 CTGAATAATTACCAGTAGGTGGG - Intronic
939548233 2:143580714-143580736 CTGTATCATTACAAATATATTGG + Intronic
940084683 2:149845670-149845692 CTGGATAAGTAGTAATAGGTTGG - Intergenic
940493612 2:154397068-154397090 GTGGAAAATTATCAATATGGAGG - Intronic
940703044 2:157070494-157070516 CTGGATAAATAACAAAATGAAGG + Intergenic
942468803 2:176238327-176238349 CTGGATATTTAACAATATCAGGG - Intergenic
942648241 2:178138179-178138201 CTGGATAATGAACAAAAAGTGGG - Intronic
942836477 2:180304721-180304743 GTAGAAAATTACCAATATTTAGG + Intergenic
944379587 2:199092534-199092556 CTGCAGAATTAACACTATGTGGG + Intergenic
1175446408 20:59023217-59023239 CAGGATCATTTCCAATATGAAGG + Intronic
1176210461 20:63918515-63918537 CTGGAAAATTATCAATAACTTGG - Intronic
1177407243 21:20685810-20685832 CTGGATATTTACCAAGAAGATGG - Intergenic
1179295356 21:40057184-40057206 CTGCATAATTAGCATGATGTAGG - Intronic
1181236082 22:21448379-21448401 CTGGCTAATTACCAAGATGAGGG - Exonic
949440430 3:4074240-4074262 CTGGATAAATAACAAAATGAAGG + Intronic
949964998 3:9348450-9348472 CTGGATCAACACCAATTTGTAGG - Intronic
951361087 3:21725083-21725105 CTGGATAAATAACAAAATGAGGG + Intronic
952243506 3:31560185-31560207 CAGGATTATTATTAATATGTGGG + Intronic
954432734 3:50479871-50479893 ATGGAAAATTACAAAGATGTGGG - Intronic
955152952 3:56386797-56386819 CTGTATAATTAGCATTATATTGG - Intronic
956555342 3:70515637-70515659 CTGGTTAATCACCAAGATGTTGG - Intergenic
957159452 3:76589994-76590016 CCGGATAATGAAAAATATGTAGG + Intronic
957312262 3:78535870-78535892 CTCGATTATTTCCAATATCTAGG - Intergenic
958754091 3:98229237-98229259 CTTGATAATTGCCTCTATGTGGG + Intergenic
959921294 3:111871253-111871275 CTGGATAATTGCATTTATGTAGG + Intronic
962208784 3:133458786-133458808 CTGGTTGACTACCAATATCTGGG + Intronic
962535141 3:136321784-136321806 CTGGTTTATTGCCAATATATAGG + Intronic
963667912 3:148213028-148213050 GTGGGTAATTACCAACAGGTAGG - Intergenic
964995281 3:162870720-162870742 CTGGATAAATAACAAAATGAAGG + Intergenic
966748232 3:183298512-183298534 ATTAATAATTACCATTATGTAGG + Intronic
970747457 4:19316638-19316660 CTAAATAATTTCCAACATGTTGG - Intergenic
973369361 4:49233518-49233540 CTGGATGATGTCCAAGATGTTGG + Intergenic
973391675 4:49561898-49561920 CTGGATGATGTCCAAGATGTTGG - Intergenic
974589823 4:63931191-63931213 CAAGGTAATTACCAATAAGTAGG - Intergenic
975048867 4:69834099-69834121 CTGGATAATTACCAATATGTAGG - Intronic
978168220 4:105634364-105634386 CTTGCTAATTTCCAATTTGTAGG - Intronic
978714876 4:111829891-111829913 CTGAACAATTTCCAATATTTAGG + Intergenic
980001851 4:127498396-127498418 CTGGCTAAATATGAATATGTGGG + Intergenic
980748635 4:137058121-137058143 CTGGTACATTCCCAATATGTGGG - Intergenic
981214183 4:142144266-142144288 CTGTATAATTTCAAATATTTTGG + Intronic
981508111 4:145525503-145525525 CTGGCAAATTAACAAAATGTGGG - Intronic
981803620 4:148686903-148686925 CAGGAAAATGACCAAAATGTTGG - Intergenic
982963382 4:161869803-161869825 CTGGACAAATACCTATCTGTAGG - Intronic
984093115 4:175400198-175400220 CTGAACAATTAAAAATATGTGGG - Intergenic
984369462 4:178843724-178843746 TTGGATAAATACCCATAAGTAGG - Intergenic
987949554 5:24657943-24657965 CTGGATAAATAGCAAAATGAAGG - Intergenic
988671996 5:33391583-33391605 CTGGATAAATAACAAAATGAAGG + Intergenic
989009131 5:36850189-36850211 CTGGATAAATAACAAAATGAAGG + Intergenic
989959162 5:50389881-50389903 CTGGATAAATAACAAAATGAAGG + Intergenic
990259317 5:54004723-54004745 CTGGATGGTTACAAATTTGTAGG + Intronic
990292809 5:54371515-54371537 CTGGAAAATTAAAAATTTGTGGG - Intergenic
990898642 5:60726875-60726897 CTGGAGCATTCCCAATATATCGG - Intergenic
994534054 5:101005780-101005802 CTGGATTATTTACAAAATGTTGG + Intergenic
995106795 5:108384006-108384028 CTGGATAAATACCTAGATGTGGG - Intergenic
997666237 5:135631581-135631603 CTGGAAAATTAGCCATTTGTTGG - Intergenic
1000078115 5:157814184-157814206 CTGGAAAATTACCACTTTGTAGG - Exonic
1003684163 6:8284238-8284260 CTGGATAAATACCCAGAAGTGGG - Intergenic
1006963568 6:37959001-37959023 CTGGGTCATTACCCATTTGTTGG + Intronic
1010887059 6:81256862-81256884 CTGGATAAATAACAAAATGAAGG + Intergenic
1014973279 6:127845845-127845867 CTGGATTCTTAGGAATATGTTGG - Intronic
1016117645 6:140307532-140307554 CTTGAAAATTACCAATTTCTTGG - Intergenic
1021453703 7:20806072-20806094 CTGTATAACTACCAATATGGAGG + Intergenic
1022262138 7:28716518-28716540 ATGGATGATTAGCTATATGTTGG + Intronic
1026369821 7:69688263-69688285 CTGAATAATTATCAGTGTGTGGG + Intronic
1029018826 7:97342530-97342552 CTGAATAATTGCAAATAAGTGGG - Intergenic
1031299433 7:120045554-120045576 CTTGATAATTGAAAATATGTTGG + Intergenic
1037846279 8:22285564-22285586 TTGGATAAATACCAAGAAGTGGG + Intronic
1038181261 8:25230405-25230427 CTGGAATAATACCTATATGTAGG + Intronic
1039304336 8:36244768-36244790 CAGGAAAATGACCAATGTGTGGG + Intergenic
1040693229 8:49964746-49964768 CTGGATAAATATCAAAATGTTGG - Intronic
1042494025 8:69435968-69435990 CTGGATAAATACCCAGAAGTGGG - Intergenic
1042901218 8:73730249-73730271 ATGGAAATTTACAAATATGTGGG - Intronic
1046194271 8:110838318-110838340 TTGGATATATACCCATATGTAGG - Intergenic
1046584686 8:116136408-116136430 CTGCATAATTACCAAATGGTAGG - Intergenic
1047590672 8:126323664-126323686 CTGGATAATTATTTATTTGTGGG + Intergenic
1048141780 8:131802016-131802038 AAGGGTAATTACCAATATCTGGG + Intergenic
1052152776 9:25139782-25139804 CTGGATAAATACCAAGTAGTGGG - Intergenic
1054837393 9:69692250-69692272 TTGGATAATTACCCAGAAGTGGG + Intergenic
1056319196 9:85420654-85420676 CTGGATAATTTTTAATAAGTAGG - Intergenic
1056663902 9:88565362-88565384 TTGGATAAATACCAAGAAGTAGG + Intronic
1056742033 9:89265415-89265437 CATGGTAACTACCAATATGTGGG + Intergenic
1058202729 9:102064418-102064440 CTGGATAAATAACAAAATGAAGG - Intergenic
1059934560 9:119296503-119296525 TTGGATAAATACCTATAAGTGGG - Intronic
1188201977 X:27302423-27302445 CTGGATAATTAACAAAATTAAGG + Intergenic
1188215703 X:27474357-27474379 CTGGATATGTACGCATATGTGGG - Intergenic
1189618810 X:42813914-42813936 CTGGATAAATAACAAAATGAAGG - Intergenic
1190361923 X:49657685-49657707 CTAGATAAATGCAAATATGTTGG + Intergenic
1192695013 X:73404254-73404276 CTGGATAAATAACAAAATGAAGG + Intergenic
1193542721 X:82791215-82791237 CTGGATAAATAACAAAATGAAGG + Intergenic
1198266047 X:135009887-135009909 CTGGATTATTAACAAGATGAGGG + Intergenic
1198266209 X:135011334-135011356 CTGGATTATCACCAAGATGAAGG + Intergenic
1198266290 X:135012063-135012085 CTGGATTATGACCAAGATGAGGG + Intergenic