ID: 975058325

View in Genome Browser
Species Human (GRCh38)
Location 4:69963819-69963841
Sequence CCTGGTCCCTAGACAGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975058325_975058329 26 Left 975058325 4:69963819-69963841 CCAGACACTGTCTAGGGACCAGG No data
Right 975058329 4:69963868-69963890 GTCCTGATATTACTCCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975058325 Original CRISPR CCTGGTCCCTAGACAGTGTC TGG (reversed) Intergenic
No off target data available for this crispr