ID: 975058473

View in Genome Browser
Species Human (GRCh38)
Location 4:69966310-69966332
Sequence ACTTGAAGAGGGAATCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975058468_975058473 -7 Left 975058468 4:69966294-69966316 CCTCTGTAATGGAATAACTTGAA No data
Right 975058473 4:69966310-69966332 ACTTGAAGAGGGAATCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975058473 Original CRISPR ACTTGAAGAGGGAATCTGGG TGG Intergenic
No off target data available for this crispr