ID: 975059301

View in Genome Browser
Species Human (GRCh38)
Location 4:69978110-69978132
Sequence TGAGCTCCTTTCCCACTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975059297_975059301 20 Left 975059297 4:69978067-69978089 CCTTGCATTTTCAGCCATGTTCC No data
Right 975059301 4:69978110-69978132 TGAGCTCCTTTCCCACTTGAAGG No data
975059299_975059301 -1 Left 975059299 4:69978088-69978110 CCCACTCAGTGCTCTGAGACTAT No data
Right 975059301 4:69978110-69978132 TGAGCTCCTTTCCCACTTGAAGG No data
975059300_975059301 -2 Left 975059300 4:69978089-69978111 CCACTCAGTGCTCTGAGACTATG No data
Right 975059301 4:69978110-69978132 TGAGCTCCTTTCCCACTTGAAGG No data
975059298_975059301 6 Left 975059298 4:69978081-69978103 CCATGTTCCCACTCAGTGCTCTG No data
Right 975059301 4:69978110-69978132 TGAGCTCCTTTCCCACTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975059301 Original CRISPR TGAGCTCCTTTCCCACTTGA AGG Intergenic
No off target data available for this crispr