ID: 975062929

View in Genome Browser
Species Human (GRCh38)
Location 4:70025727-70025749
Sequence AGGCCATTTTAGAAGACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975062929_975062931 -9 Left 975062929 4:70025727-70025749 CCATCAGTCTTCTAAAATGGCCT No data
Right 975062931 4:70025741-70025763 AAATGGCCTACTGTTTCTGGAGG No data
975062929_975062932 -8 Left 975062929 4:70025727-70025749 CCATCAGTCTTCTAAAATGGCCT No data
Right 975062932 4:70025742-70025764 AATGGCCTACTGTTTCTGGAGGG No data
975062929_975062934 17 Left 975062929 4:70025727-70025749 CCATCAGTCTTCTAAAATGGCCT No data
Right 975062934 4:70025767-70025789 AGACCATAACTAGCATGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975062929 Original CRISPR AGGCCATTTTAGAAGACTGA TGG (reversed) Intergenic
No off target data available for this crispr