ID: 975064452

View in Genome Browser
Species Human (GRCh38)
Location 4:70043020-70043042
Sequence CCCAGGGGCAGCGTTTGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975064445_975064452 5 Left 975064445 4:70042992-70043014 CCAGACACTTTCACTTGGCTTCT No data
Right 975064452 4:70043020-70043042 CCCAGGGGCAGCGTTTGCCTGGG No data
975064442_975064452 8 Left 975064442 4:70042989-70043011 CCCCCAGACACTTTCACTTGGCT No data
Right 975064452 4:70043020-70043042 CCCAGGGGCAGCGTTTGCCTGGG No data
975064443_975064452 7 Left 975064443 4:70042990-70043012 CCCCAGACACTTTCACTTGGCTT No data
Right 975064452 4:70043020-70043042 CCCAGGGGCAGCGTTTGCCTGGG No data
975064444_975064452 6 Left 975064444 4:70042991-70043013 CCCAGACACTTTCACTTGGCTTC No data
Right 975064452 4:70043020-70043042 CCCAGGGGCAGCGTTTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975064452 Original CRISPR CCCAGGGGCAGCGTTTGCCT GGG Intergenic