ID: 975064510

View in Genome Browser
Species Human (GRCh38)
Location 4:70043486-70043508
Sequence GAGAAGAGTCAGAACACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975064510_975064512 -3 Left 975064510 4:70043486-70043508 CCTTCAGTGTTCTGACTCTTCTC No data
Right 975064512 4:70043506-70043528 CTCTGAGGCCCCACATGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975064510 Original CRISPR GAGAAGAGTCAGAACACTGA AGG (reversed) Intergenic
No off target data available for this crispr