ID: 975064850

View in Genome Browser
Species Human (GRCh38)
Location 4:70047985-70048007
Sequence AAGCCATTTTAGAAGACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975064850_975064855 17 Left 975064850 4:70047985-70048007 CCATCAGTCTTCTAAAATGGCTT No data
Right 975064855 4:70048025-70048047 AGACCATCCCTAGCATGAGAAGG No data
975064850_975064852 -9 Left 975064850 4:70047985-70048007 CCATCAGTCTTCTAAAATGGCTT No data
Right 975064852 4:70047999-70048021 AAATGGCTTACTGTTCCTGGAGG No data
975064850_975064853 -8 Left 975064850 4:70047985-70048007 CCATCAGTCTTCTAAAATGGCTT No data
Right 975064853 4:70048000-70048022 AATGGCTTACTGTTCCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975064850 Original CRISPR AAGCCATTTTAGAAGACTGA TGG (reversed) Intergenic
No off target data available for this crispr