ID: 975065830

View in Genome Browser
Species Human (GRCh38)
Location 4:70062370-70062392
Sequence CTAAAGATAAAAGTTACCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975065830_975065833 14 Left 975065830 4:70062370-70062392 CCACTGGTAACTTTTATCTTTAG No data
Right 975065833 4:70062407-70062429 CCAGCTAAAGCTCCTGAAGATGG No data
975065830_975065834 15 Left 975065830 4:70062370-70062392 CCACTGGTAACTTTTATCTTTAG No data
Right 975065834 4:70062408-70062430 CAGCTAAAGCTCCTGAAGATGGG No data
975065830_975065836 26 Left 975065830 4:70062370-70062392 CCACTGGTAACTTTTATCTTTAG No data
Right 975065836 4:70062419-70062441 CCTGAAGATGGGCAACCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975065830 Original CRISPR CTAAAGATAAAAGTTACCAG TGG (reversed) Intergenic