ID: 975065831

View in Genome Browser
Species Human (GRCh38)
Location 4:70062406-70062428
Sequence CATCTTCAGGAGCTTTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975065831_975065836 -10 Left 975065831 4:70062406-70062428 CCCAGCTAAAGCTCCTGAAGATG No data
Right 975065836 4:70062419-70062441 CCTGAAGATGGGCAACCACACGG No data
975065831_975065838 7 Left 975065831 4:70062406-70062428 CCCAGCTAAAGCTCCTGAAGATG No data
Right 975065838 4:70062436-70062458 ACACGGCCACCCAAGAGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975065831 Original CRISPR CATCTTCAGGAGCTTTAGCT GGG (reversed) Intergenic
No off target data available for this crispr