ID: 975065836

View in Genome Browser
Species Human (GRCh38)
Location 4:70062419-70062441
Sequence CCTGAAGATGGGCAACCACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975065831_975065836 -10 Left 975065831 4:70062406-70062428 CCCAGCTAAAGCTCCTGAAGATG No data
Right 975065836 4:70062419-70062441 CCTGAAGATGGGCAACCACACGG No data
975065830_975065836 26 Left 975065830 4:70062370-70062392 CCACTGGTAACTTTTATCTTTAG No data
Right 975065836 4:70062419-70062441 CCTGAAGATGGGCAACCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975065836 Original CRISPR CCTGAAGATGGGCAACCACA CGG Intergenic
No off target data available for this crispr