ID: 975065838

View in Genome Browser
Species Human (GRCh38)
Location 4:70062436-70062458
Sequence ACACGGCCACCCAAGAGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975065835_975065838 -6 Left 975065835 4:70062419-70062441 CCTGAAGATGGGCAACCACACGG No data
Right 975065838 4:70062436-70062458 ACACGGCCACCCAAGAGTCAAGG No data
975065832_975065838 6 Left 975065832 4:70062407-70062429 CCAGCTAAAGCTCCTGAAGATGG No data
Right 975065838 4:70062436-70062458 ACACGGCCACCCAAGAGTCAAGG No data
975065831_975065838 7 Left 975065831 4:70062406-70062428 CCCAGCTAAAGCTCCTGAAGATG No data
Right 975065838 4:70062436-70062458 ACACGGCCACCCAAGAGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975065838 Original CRISPR ACACGGCCACCCAAGAGTCA AGG Intergenic
No off target data available for this crispr