ID: 975069854

View in Genome Browser
Species Human (GRCh38)
Location 4:70120341-70120363
Sequence AACCTGTAACTACTACCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975069846_975069854 18 Left 975069846 4:70120300-70120322 CCAAGGACTGAACCCCCAGACTT No data
Right 975069854 4:70120341-70120363 AACCTGTAACTACTACCAAGTGG No data
975069848_975069854 6 Left 975069848 4:70120312-70120334 CCCCCAGACTTACTCTGGTGCCA No data
Right 975069854 4:70120341-70120363 AACCTGTAACTACTACCAAGTGG No data
975069849_975069854 5 Left 975069849 4:70120313-70120335 CCCCAGACTTACTCTGGTGCCAG No data
Right 975069854 4:70120341-70120363 AACCTGTAACTACTACCAAGTGG No data
975069843_975069854 30 Left 975069843 4:70120288-70120310 CCAAGCCAGTACCCAAGGACTGA No data
Right 975069854 4:70120341-70120363 AACCTGTAACTACTACCAAGTGG No data
975069844_975069854 25 Left 975069844 4:70120293-70120315 CCAGTACCCAAGGACTGAACCCC No data
Right 975069854 4:70120341-70120363 AACCTGTAACTACTACCAAGTGG No data
975069845_975069854 19 Left 975069845 4:70120299-70120321 CCCAAGGACTGAACCCCCAGACT No data
Right 975069854 4:70120341-70120363 AACCTGTAACTACTACCAAGTGG No data
975069850_975069854 4 Left 975069850 4:70120314-70120336 CCCAGACTTACTCTGGTGCCAGG No data
Right 975069854 4:70120341-70120363 AACCTGTAACTACTACCAAGTGG No data
975069852_975069854 3 Left 975069852 4:70120315-70120337 CCAGACTTACTCTGGTGCCAGGT No data
Right 975069854 4:70120341-70120363 AACCTGTAACTACTACCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975069854 Original CRISPR AACCTGTAACTACTACCAAG TGG Intergenic
No off target data available for this crispr