ID: 975072896

View in Genome Browser
Species Human (GRCh38)
Location 4:70164385-70164407
Sequence CTGATCCAATGTAGGATATA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975072896_975072899 5 Left 975072896 4:70164385-70164407 CCCTATATCCTACATTGGATCAG 0: 1
1: 0
2: 2
3: 8
4: 79
Right 975072899 4:70164413-70164435 TACTGTTATGTATAGCCATGAGG 0: 1
1: 0
2: 0
3: 9
4: 126
975072896_975072900 11 Left 975072896 4:70164385-70164407 CCCTATATCCTACATTGGATCAG 0: 1
1: 0
2: 2
3: 8
4: 79
Right 975072900 4:70164419-70164441 TATGTATAGCCATGAGGACATGG 0: 1
1: 0
2: 2
3: 11
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975072896 Original CRISPR CTGATCCAATGTAGGATATA GGG (reversed) Exonic
908726561 1:67183078-67183100 CTGATCATAAGTAGGAAATAAGG - Intronic
908983949 1:69994018-69994040 CTGATCCAAGGCAGGATTTATGG + Intronic
912531822 1:110329927-110329949 CTTTTCCCATCTAGGATATAAGG + Intergenic
914255510 1:145958992-145959014 CTGAGCCACTGTAGGAGAGATGG - Intergenic
916604731 1:166329732-166329754 CTGGTCCTTTGTAGGATATGTGG + Intergenic
916692801 1:167206882-167206904 CTGATACAATGTGGTTTATATGG + Intergenic
918577356 1:186079047-186079069 CTGATCCTAGGCAGGACATATGG - Intronic
918975645 1:191482036-191482058 CTGATCCAAAATAGGATCAAAGG - Intergenic
920624612 1:207584891-207584913 CTGAACCCATTTAGGATATGTGG - Intronic
920627485 1:207616817-207616839 CTGAACCCATTTAGGATATGTGG - Intronic
920637429 1:207717706-207717728 CTGAACCCATTTAGGATATGTGG - Intronic
920764091 1:208814782-208814804 CTGATCCAATAGATGATATTAGG + Intergenic
924015965 1:239723650-239723672 CTGATCATTTGCAGGATATAAGG + Intronic
1065010069 10:21412812-21412834 ATGATCCAATGCAGGATCCAGGG + Intergenic
1067657399 10:48206583-48206605 CTGATGCATTGCAGGATATTTGG - Intronic
1068992924 10:63169350-63169372 CTGATCCAATCTGGGATTTGTGG + Intronic
1071472142 10:85991207-85991229 CTGATTGAATGTAGAATACAAGG + Intronic
1075595716 10:123727722-123727744 CTGATGCACTGTTGGTTATAAGG - Intronic
1080088795 11:28318794-28318816 CTCATCCAATGCAGTATATATGG - Intronic
1090563658 11:127962505-127962527 CTGTTCCAAAGTTGGATTTATGG + Intergenic
1090748306 11:129724490-129724512 ATGATCCAATGTGGGATTCAGGG - Intergenic
1095618476 12:44221547-44221569 CTGCTATAATGTGGGATATAGGG + Intronic
1098846746 12:75546732-75546754 CAGATCCAAGGTACCATATATGG + Intergenic
1102795419 12:115685140-115685162 ATGAACCAATGAATGATATATGG + Intergenic
1105950170 13:25223174-25223196 ATGATCCAGTGTATGCTATATGG + Intergenic
1108503802 13:51091397-51091419 CTTATCCCATGAAGGATTTAGGG - Intergenic
1109794047 13:67286765-67286787 CTGATCCAATGGCTGATATATGG + Intergenic
1109898973 13:68737677-68737699 CTGATCTAGTGTAGGATAATTGG + Intergenic
1112892959 13:104261368-104261390 ATGATGGAATGTAGGATATAAGG - Intergenic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1127481587 15:59382845-59382867 CTGATGCCATGTAGGAAACATGG + Intronic
1127744453 15:61952279-61952301 CTTATGCACTGTAGGATATGAGG + Intronic
1128393623 15:67200943-67200965 CTAATCCAATGAAGGATATAGGG + Intergenic
1131857689 15:96616302-96616324 GAGATCCAATGTAGGGCATATGG + Intergenic
1137577186 16:49608012-49608034 CTGATCCAGTGTTGAAGATATGG - Intronic
1138650635 16:58459003-58459025 CTGATCCAGTGTAGGATGGATGG + Intergenic
1144322051 17:14135478-14135500 CTGACCCAAAGTAGAATATCCGG - Intronic
1150206017 17:63408237-63408259 CTGATTAGATGTAGGAAATAAGG + Intronic
1150212774 17:63450532-63450554 CTGCTCCACTGCAGGATATGGGG - Intergenic
1157225853 18:45863899-45863921 CAAATCCCAAGTAGGATATATGG - Intronic
1157781431 18:50443343-50443365 CTGATACAATGTGGGAGATGGGG - Intergenic
1164154593 19:22583894-22583916 CTGATACAATTAAGGATATACGG + Intergenic
1165075465 19:33277796-33277818 CTGCTCCACTGTGGGATAGAAGG + Intergenic
927333871 2:21897825-21897847 TTGAGCCAAAGTAGGATATAAGG + Intergenic
928251221 2:29682645-29682667 CTGAAGCAATATTGGATATAAGG + Intronic
938732855 2:134159987-134160009 CTGATGCAGTTTAGGATACATGG - Intronic
1170380631 20:15755996-15756018 TTGGTCCAATGTAGAATAGATGG + Intronic
1172822017 20:37744932-37744954 CTGTTTCAGTGTATGATATAAGG - Intronic
1177027249 21:15934718-15934740 CTGATCCAAGGTAGTATGTTGGG - Intergenic
1178133675 21:29601788-29601810 CCAATCCAATTGAGGATATAAGG - Intronic
1183150577 22:36034038-36034060 CTTGTCCAAGGTAAGATATATGG - Intergenic
959780762 3:110230649-110230671 CTGATACTATATAGTATATACGG + Intergenic
962728309 3:138256049-138256071 CTGCTCCAATGTAAGATGTTTGG - Intronic
967949981 3:194833191-194833213 GTGATCCAATGTAGGGTAGGAGG - Intergenic
973118048 4:46486005-46486027 ATGATCAAATGTATTATATATGG - Intergenic
973700148 4:53529198-53529220 CTGACACAATCTAGGAGATAAGG + Intronic
974419644 4:61656714-61656736 GAAATCCAATGTAGGATTTAGGG + Intronic
975072896 4:70164385-70164407 CTGATCCAATGTAGGATATAGGG - Exonic
978002462 4:103573126-103573148 CTGATCAGATGTTGGATATGGGG + Intergenic
981554242 4:145975501-145975523 CTAATCCTTTGTTGGATATATGG - Intergenic
985253350 4:188044708-188044730 CTGATTCACTGAATGATATATGG - Intergenic
986790883 5:11158704-11158726 CTGATCAACTGTAGGAGAAATGG + Intronic
987965843 5:24871665-24871687 CTTATCCAATTTAGTATTTAAGG + Intergenic
994380400 5:99064021-99064043 CAGATCCAATGTAGGATTTATGG + Intergenic
997035220 5:130182654-130182676 GTCATCCATTGTAGGATGTAGGG + Intronic
998113205 5:139517840-139517862 GGGATCCAATGTGGGATCTAAGG + Intergenic
1000757860 5:165183863-165183885 CTGTTCCAATGGAGGTGATAGGG + Intergenic
1000868508 5:166545623-166545645 AGTATCCAATGTAGTATATAAGG - Intergenic
1015826373 6:137316907-137316929 AAGATCAGATGTAGGATATATGG + Intergenic
1017849453 6:158292072-158292094 CTGTCCCAATTTAGGAAATAAGG - Intronic
1022824571 7:33995844-33995866 CAGATCCCAGGTAGAATATATGG - Intronic
1024126335 7:46300585-46300607 CTAATCCATTGTAAGATATGTGG - Intergenic
1026235929 7:68527388-68527410 TTGATCCAATGTAGAGCATATGG - Intergenic
1028660221 7:93262905-93262927 ATGATATAATGTGGGATATAAGG + Intronic
1028889328 7:95969396-95969418 CTGAGCTAATCTAGGAAATAGGG + Intronic
1029015510 7:97311855-97311877 TTGATCCAATGTAGATTATGTGG + Intergenic
1030400169 7:109039637-109039659 CTGATCAATTTGAGGATATAAGG + Intergenic
1031474262 7:122203962-122203984 CTGAACCAGTGTCCGATATATGG - Intergenic
1032272666 7:130424945-130424967 CTGATCCTTTGTCAGATATATGG - Intronic
1033180130 7:139168985-139169007 CTGTTCCAAGGTCTGATATATGG + Intronic
1041764246 8:61401441-61401463 CTGAACAAATGTGGGATAGAAGG - Intronic
1043252831 8:78097174-78097196 CTGATCCAATGCCCCATATATGG - Intergenic
1043462259 8:80472118-80472140 CTGATCTAATGGAATATATAGGG - Intergenic
1051701159 9:19825500-19825522 CTCATTCAATATGGGATATAGGG + Intergenic
1057905058 9:98976815-98976837 CTGACTCTATGTAGCATATATGG - Intronic
1189474990 X:41345200-41345222 CTGATCGGATGTTGGATATGGGG + Exonic
1194007185 X:88509112-88509134 CTATTCCAGTGTAGGATATTTGG + Intergenic
1195801688 X:108719143-108719165 CTGATGGAATATAGGATAGATGG - Intergenic
1198890504 X:141390404-141390426 TTAATCCAAAGTAGGAAATAAGG + Intergenic
1199898641 X:152151329-152151351 TTGAGTCAATGTAGGAAATAGGG - Intergenic