ID: 975075177

View in Genome Browser
Species Human (GRCh38)
Location 4:70198072-70198094
Sequence CTGGGCTCCTTGGGCAAAAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 12, 3: 34, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975075177_975075187 30 Left 975075177 4:70198072-70198094 CCAGTTTTGCCCAAGGAGCCCAG 0: 1
1: 0
2: 12
3: 34
4: 165
Right 975075187 4:70198125-70198147 ACACCGCCTCAGACACAACCAGG 0: 1
1: 0
2: 4
3: 80
4: 1666

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975075177 Original CRISPR CTGGGCTCCTTGGGCAAAAC TGG (reversed) Exonic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900486197 1:2923957-2923979 CTGGGGGTCTTGGGCAAAGCAGG - Intergenic
902600461 1:17537411-17537433 CTGGGCTCTGAGGGCACAACGGG + Intergenic
904292261 1:29495524-29495546 CTGGGGTCCTTGGAGAAATCTGG - Intergenic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
913539894 1:119808714-119808736 CTGAGCTGCCTGGCCAAAACAGG - Exonic
913653903 1:120943501-120943523 TTGGGTTCCTTGGGCCACACTGG - Intergenic
916976430 1:170085067-170085089 ATGGGCTCCTTGGGCCCCACTGG - Intronic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
919465335 1:197917957-197917979 CTGGGCGCCTTTGGCCAGACGGG - Exonic
920389752 1:205592021-205592043 CTGGGCTCCTTGGGCTAGAGAGG + Intronic
921077158 1:211709077-211709099 CTGGACCCCTTGGGAAAAGCAGG + Intergenic
921159818 1:212464914-212464936 GTGGCCTCCTTGGGCAAGCCAGG - Intergenic
921959803 1:221022710-221022732 CTGGCATCCTAGGGTAAAACAGG - Intergenic
922759621 1:228119241-228119263 TGGAGCTCCTTGGGAAAAACAGG - Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1063050407 10:2441118-2441140 ATGGGATCCTTGGAGAAAACTGG + Intergenic
1063394587 10:5675153-5675175 CTGTGCCCCTTGGTCAAATCTGG - Intergenic
1067070285 10:43126101-43126123 CAGGGGTCCTTGGGGAAAGCTGG + Intronic
1072424167 10:95315337-95315359 CTGGGTTCCTTCTGAAAAACAGG - Intronic
1075841097 10:125504368-125504390 CTGGGCCTCTTGTGCCAAACAGG + Intergenic
1077477643 11:2797909-2797931 CTGGGCTGCCTGGGCCAACCTGG - Intronic
1077478919 11:2803818-2803840 CTGGGGTCCATGGGCATAGCAGG - Intronic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1077951752 11:6966839-6966861 CTGGGATCCATGTGCAGAACAGG + Intronic
1078698449 11:13658472-13658494 CTGAGATCCCTGGGAAAAACAGG - Intergenic
1079454797 11:20626889-20626911 CTGGGAGGCTTGGGCAAAAAGGG + Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081839078 11:46182794-46182816 CTGGCCTCCTTCAGCAAGACTGG - Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083298119 11:61726144-61726166 GTTGGCTCCTTTGGCAAAGCAGG + Intronic
1083553822 11:63610158-63610180 CTGTGCTCCCATGGCAAAACTGG + Intronic
1083749523 11:64753679-64753701 CTGGGCTCTCTGGGCACAGCGGG - Exonic
1084148932 11:67279104-67279126 TTGGGCTCCCTGGGCAGAACTGG - Intronic
1084505333 11:69563283-69563305 CTGGGCTCCTTTGTCAGCACAGG - Intergenic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1087227061 11:95613278-95613300 CTGGTCTCCTTGGGAAAAACAGG - Intergenic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1089158930 11:116423216-116423238 GTGGGCTCCTTGGACAAGGCTGG + Intergenic
1089588661 11:119525973-119525995 CTGGGCTCCTTGAGCAAGCCAGG + Intergenic
1091400391 12:177526-177548 CTGGGCTCCACGGGCAGCACAGG + Exonic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1095172683 12:39054632-39054654 CTGGGCACCTTGAAAAAAACAGG + Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098213313 12:68188582-68188604 CTGGGCTCCTTCAGGAAACCTGG + Intergenic
1099202565 12:79692125-79692147 ATGTGCTACCTGGGCAAAACAGG - Intergenic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1102036973 12:109776243-109776265 CTTGTCTCATGGGGCAAAACTGG + Intergenic
1102465455 12:113128201-113128223 CTGGGGTCCTCGGGCCACACAGG + Intronic
1104752361 12:131247770-131247792 CTGGGCTCCTGGGTTAAAAACGG + Intergenic
1104779574 12:131411458-131411480 CTGGGCTCCTGGGTTAAAAACGG - Intergenic
1110268627 13:73568283-73568305 ATGGGCCTCTTGGGCAACACTGG - Intergenic
1113879237 13:113614457-113614479 CTGGGCTCCCAGGGCACAAACGG - Intronic
1113881388 13:113628707-113628729 CTGGGCCCCTAGGGAAAAAAAGG - Intronic
1114377966 14:22169638-22169660 CAGGGTCCCTTGGGCAAAGCTGG - Intergenic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1119175341 14:72564507-72564529 CGGGGATCCTTGGGCAAGGCTGG - Intronic
1120755700 14:88242072-88242094 CTCTGTTCCTTGGGCAAACCTGG + Intronic
1121429769 14:93878631-93878653 CTGGGTCCCTGGGGAAAAACAGG + Intergenic
1122742785 14:103881649-103881671 CAGGGCTGCTGGGGGAAAACGGG - Intergenic
1125878297 15:43168778-43168800 CTGCAGTCCTTGGGCAAATCTGG - Intronic
1126828604 15:52576028-52576050 CTGGGCACCTTTGTCAAAAATGG + Intergenic
1127329295 15:57923019-57923041 CTGGGCTGCTTGCCCAAATCTGG - Intergenic
1128723685 15:69972119-69972141 CTGGCCTGCTTGGTCAAAACAGG + Intergenic
1129683532 15:77671701-77671723 CTGAGCTCCTTAGGCTGAACTGG - Intronic
1129969870 15:79768813-79768835 CTGGGCTCCATCTGCAGAACAGG + Intergenic
1132496372 16:265319-265341 CTGGCCACCTTGGGCAGAGCTGG + Exonic
1132497112 16:269133-269155 CTGGGCCCCCTGGGCACAAGGGG + Exonic
1132743425 16:1427195-1427217 CTGGGGTCCGTGGGCACAGCAGG + Intergenic
1132759237 16:1500866-1500888 CTGAGCTCCTGGGGCCACACAGG + Intronic
1133592022 16:7254343-7254365 CTGGGCTCCTTAGGTTAATCGGG + Intronic
1136536666 16:30903635-30903657 CTGGGCTTCTTGGGCATGTCTGG - Intergenic
1141556215 16:84838433-84838455 CTGGGCTCCTCGGGCAGAGCTGG - Exonic
1141688178 16:85582073-85582095 CTGGGCTCCTGGGGCGGAATTGG + Intergenic
1144100748 17:11940219-11940241 CTGGGTTCCCTGAGCAAAAGAGG + Intronic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1150840064 17:68599794-68599816 CTGTGCTCTTTGGGTAAACCTGG - Intronic
1151817519 17:76478649-76478671 CTGGGATCCCTGGGCAAAGAGGG - Intronic
1152326680 17:79645602-79645624 CTGGGCTCCCTGGGCTGGACTGG - Intergenic
1152834476 17:82520225-82520247 CTGCGCTGCTTGGGCAAGAACGG + Exonic
1155696274 18:28690711-28690733 ATGGGCCCCTTGAGCAAAAATGG + Intergenic
1157280895 18:46345600-46345622 CTTGACTCCTAGGGCAAAACAGG + Intronic
1157305480 18:46514015-46514037 CTGGGCTCCTTAGGGACCACTGG + Intronic
1157437901 18:47686662-47686684 CTGGGCACTGTTGGCAAAACAGG - Intergenic
1160456828 18:79007460-79007482 CTGGGTGCCTTGGGCAGCACTGG - Intergenic
1162740758 19:12772354-12772376 CTGGGGTTATTGGGCAGAACTGG - Intronic
1163189842 19:15669644-15669666 CTGGGCTGCTTCAGCACAACAGG - Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1167221705 19:48203550-48203572 CTGGGCTGCTTTGGGAAAAATGG - Intronic
1167399572 19:49255890-49255912 GTGGGCTCCTAGGGGAAAATGGG - Intergenic
1167488395 19:49776739-49776761 CTGGGCTCCCTGGCCATCACGGG + Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168137023 19:54359055-54359077 CTGGGCTGCTGGGGCACAGCGGG - Intronic
1168161058 19:54510074-54510096 CTGGGCTGCTGGGGCACAGCGGG + Intronic
929945810 2:46370961-46370983 GTGGGCTCCTTGGGAACAAGGGG + Intronic
932534293 2:72576007-72576029 CTGGCCTACTAAGGCAAAACTGG - Intronic
932965895 2:76474217-76474239 CTGGATGCCTTGGGAAAAACAGG + Intergenic
933614278 2:84468399-84468421 CTGGACTCCTTGGGGTAAACAGG - Intergenic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
937335400 2:121059355-121059377 CTGGGCTCCTGGGGCAGAGGTGG + Intergenic
938764184 2:134449546-134449568 CTGGGCTCTCTGGACAACACAGG - Exonic
941081843 2:161070823-161070845 CTGGCCTTCTTGGGCAATGCTGG + Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
946686656 2:222278049-222278071 TTGGGCTCCTTGGGCCACACTGG - Intronic
948092386 2:235305383-235305405 CTTGTCTTCTTGGGCAAAAGGGG + Intergenic
948859225 2:240744907-240744929 CTGGGCTCCTGGGGCAGCAGGGG - Intronic
948982074 2:241499502-241499524 CTGGCCTCCTAGGGCACAGCAGG + Intronic
1169795388 20:9457278-9457300 CATGGCTCATTGGGCAACACTGG - Intronic
1170930318 20:20763861-20763883 CTGGGCTCCTTGGGAGAACTGGG + Intergenic
1170957427 20:20993965-20993987 CTGGCCTCCTTGAACAACACAGG - Intergenic
1174361609 20:50032233-50032255 CTGGCCTCCTTGGGCTTAATGGG + Intergenic
1175804520 20:61820136-61820158 CTGGGCCCTCTGGGCAAAACCGG - Intronic
1180026159 21:45163503-45163525 CCTGGCTCCTTGTGCAAAGCTGG - Intronic
1180866897 22:19124831-19124853 CTGGGCTCCCAGGGCAGATCTGG - Intergenic
1181963254 22:26638295-26638317 CTCAGGTCCTTGGGCAAAGCGGG + Intergenic
1182272939 22:29167119-29167141 CTAGGCTCCGTGGGCATATCTGG + Exonic
1183079100 22:35444929-35444951 CTGGGCTGCATGAGCATAACTGG - Intergenic
1185387798 22:50544297-50544319 CTGGGCTCCGAGCGCAAACCTGG - Intergenic
949182691 3:1153849-1153871 CTGGGATCCTTGAGCAAAGCAGG - Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
952852971 3:37744272-37744294 GAGGGCTTCTTGGGGAAAACTGG - Intronic
953393123 3:42545351-42545373 CTGGGCTCTGTGGCCAGAACAGG + Intergenic
954684010 3:52360942-52360964 CAGGGGTCCCTGGGCAAAGCTGG + Intronic
958166694 3:89885546-89885568 ATGAGCTCCTAGGGCCAAACAGG - Intergenic
960235950 3:115282333-115282355 TTGGGCTCCTGTGGAAAAACAGG + Intergenic
960661659 3:120066930-120066952 TTGGGTTCCTTGGGCGACACTGG + Intronic
961484015 3:127204961-127204983 CTGTGCACCATGGGCAAGACAGG + Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962493049 3:135911954-135911976 CAGGGATCCTTGAGAAAAACAGG - Intergenic
963064530 3:141252971-141252993 CTGGCCTCCTTGGGGAATACTGG - Intronic
965217254 3:165879284-165879306 CTGGGATACATGTGCAAAACGGG - Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
967220104 3:187241524-187241546 CCAGACTCCTTGGGCAGAACAGG + Exonic
967934177 3:194713453-194713475 CTTGGCTCCTTGAGCAGATCTGG + Intergenic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
970130333 4:12862576-12862598 CTGGGGGGCTTAGGCAAAACAGG + Intergenic
972254407 4:37337628-37337650 CTTGTCTCCTTGGGCAGCACAGG + Intronic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
975075177 4:70198072-70198094 CTGGGCTCCTTGGGCAAAACTGG - Exonic
975620661 4:76293007-76293029 CTTCGCTCATTGGGCAACACTGG + Intronic
977886442 4:102257468-102257490 AAGGCCTTCTTGGGCAAAACAGG + Intronic
980073316 4:128265977-128265999 CTGGGCACCTTGAAAAAAACAGG - Intergenic
981026895 4:140085613-140085635 CAGAGCTGCTTGGCCAAAACGGG + Intronic
982864221 4:160489884-160489906 TTGGACTCCTTGTGAAAAACAGG + Intergenic
986448876 5:7847615-7847637 CAAGGCTCCTTGGCCAAATCTGG - Intronic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
995566389 5:113435806-113435828 CTGGGCTCCCAGGGCATATCTGG + Intronic
995970892 5:117969651-117969673 TTGGGCTACATGGGCAAGACAGG + Intergenic
999641557 5:153678174-153678196 TTGGGCTCCTTGGGGAGAAGAGG + Intronic
1001241745 5:170076573-170076595 CTGAGCTCCTTGGCCTAAAGAGG + Intronic
1002442181 5:179270230-179270252 GTGGGCTTCTCGGGGAAAACAGG + Intronic
1002453495 5:179332607-179332629 CTGGGCTTCTGGGGCAATGCAGG - Intronic
1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG + Intronic
1004389900 6:15201370-15201392 CTGGGCTCAGTGTGCAATACAGG - Intergenic
1006819465 6:36880266-36880288 CTGGAATCCATGGGAAAAACAGG + Intronic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1013598829 6:111685288-111685310 CTGGGCTGCATGGGCAGCACTGG + Intronic
1015163432 6:130177791-130177813 CTGGGCTTGGTGGGCAAAGCAGG - Intronic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1016796134 6:148119566-148119588 CTGGGCTCTTTGGAAAAAACAGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017143107 6:151209686-151209708 CTGGGCTCCTTGGGAAATGGAGG - Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1017681229 6:156866065-156866087 GTGGGCTCCTTAGGGAAATCTGG + Intronic
1021659815 7:22908787-22908809 CTGGGGGCCTTGGGCCACACTGG + Intergenic
1023588597 7:41757621-41757643 CTGAGCTCCTTGGGAAAAACAGG - Intergenic
1023618445 7:42045169-42045191 CTGGTATCCTTGAGCTAAACAGG + Intronic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1025947387 7:66114991-66115013 TTGGGCTCCTCGGGCGAAAAGGG - Intronic
1026391602 7:69908256-69908278 CTGGGTTCCTGTGGCAAAGCAGG - Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030400736 7:109046444-109046466 CTGGTTTCCTTGGACAATACAGG + Intergenic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1031742892 7:125456450-125456472 CTGGACTTATTGGGAAAAACAGG - Intergenic
1032087713 7:128892514-128892536 CTGGGCACCTGGGGCAACACTGG + Exonic
1034566281 7:151918217-151918239 CTGGACTGCTTGGGCACAGCTGG + Intergenic
1035456748 7:159013884-159013906 CTGGCCTCAGTGGGCAAACCTGG + Intergenic
1036683229 8:10891383-10891405 CTGGGATCCTTGGGCTAGAGTGG - Intergenic
1040768850 8:50949460-50949482 CTGGGCTCCTTATGCAACATAGG - Intergenic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1047413718 8:124646130-124646152 CTAGGCTCCTTTGGGAAACCAGG + Intronic
1048330951 8:133470586-133470608 CTGAGCTCCTTGGGAAGCACGGG + Intronic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1050657902 9:7849035-7849057 CTGGACTCCTTGGTAAAAACAGG + Intronic
1051469679 9:17423610-17423632 CTGCGGTCCTTGGGCAAGTCTGG - Intronic
1051894003 9:21969943-21969965 TTGGGCTCCTTGGGCCATAGGGG - Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1054916500 9:70499464-70499486 CTGGGCTCAGTGGGCAAAAACGG - Intergenic
1055702593 9:78961676-78961698 CTGAGCTCCATGTGCAAAAAAGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056726926 9:89127441-89127463 TGGGGCTCCTTGAGAAAAACAGG + Intronic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058630093 9:106977611-106977633 CTTGGTTCTTTGGGCAAAATGGG + Intronic
1058826035 9:108776831-108776853 GTGGTCTCCTTGGCCAAAAGGGG - Intergenic
1058895511 9:109397457-109397479 GTGGGCTCTTTGGGAAAAATGGG - Intronic
1059371728 9:113845050-113845072 CTGGTCCCTTTGGCCAAAACAGG + Intergenic
1059399468 9:114059774-114059796 CTGAGCTCCTTGGGCACAGCAGG + Intergenic
1060443107 9:123660156-123660178 CTGGGCTCCCTGTCTAAAACGGG + Intronic
1061296929 9:129681884-129681906 CTGGGCTCCCTGGGGATCACGGG + Intronic
1186640468 X:11449816-11449838 ATAGGCGCCTTAGGCAAAACTGG + Intronic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192590034 X:72351945-72351967 GAGGCCTCCTTGGGCAGAACAGG + Intronic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic
1200249524 X:154545448-154545470 ATGGACTTCTTGGGGAAAACAGG - Intronic
1201550773 Y:15214358-15214380 CTGGACTCCTAGGGCAATCCAGG - Intergenic