ID: 975078118

View in Genome Browser
Species Human (GRCh38)
Location 4:70238809-70238831
Sequence GGCCATCTGGTGACTCCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975078118_975078123 1 Left 975078118 4:70238809-70238831 CCTATAGGAGTCACCAGATGGCC No data
Right 975078123 4:70238833-70238855 CTGAGCCACTAGTAGTATCATGG No data
975078118_975078125 17 Left 975078118 4:70238809-70238831 CCTATAGGAGTCACCAGATGGCC No data
Right 975078125 4:70238849-70238871 ATCATGGTACTGTTTCCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975078118 Original CRISPR GGCCATCTGGTGACTCCTAT AGG (reversed) Intergenic
No off target data available for this crispr