ID: 975080841

View in Genome Browser
Species Human (GRCh38)
Location 4:70278629-70278651
Sequence TTAAGCAATTAGAATAATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975080840_975080841 14 Left 975080840 4:70278592-70278614 CCAAATAAAGCTATTTTTAAAAA No data
Right 975080841 4:70278629-70278651 TTAAGCAATTAGAATAATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975080841 Original CRISPR TTAAGCAATTAGAATAATCT TGG Intergenic
No off target data available for this crispr