ID: 975085705

View in Genome Browser
Species Human (GRCh38)
Location 4:70336158-70336180
Sequence AGACACCTCCACAACTGAAA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 171}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975085704_975085705 -9 Left 975085704 4:70336144-70336166 CCAGACTATAAGGAAGACACCTC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 975085705 4:70336158-70336180 AGACACCTCCACAACTGAAACGG 0: 1
1: 0
2: 1
3: 17
4: 171
975085699_975085705 24 Left 975085699 4:70336111-70336133 CCATTTTCTGGAACTACCTCTGT 0: 1
1: 0
2: 3
3: 27
4: 265
Right 975085705 4:70336158-70336180 AGACACCTCCACAACTGAAACGG 0: 1
1: 0
2: 1
3: 17
4: 171
975085700_975085705 8 Left 975085700 4:70336127-70336149 CCTCTGTATTAGATACCCCAGAC 0: 1
1: 0
2: 0
3: 5
4: 110
Right 975085705 4:70336158-70336180 AGACACCTCCACAACTGAAACGG 0: 1
1: 0
2: 1
3: 17
4: 171
975085702_975085705 -7 Left 975085702 4:70336142-70336164 CCCCAGACTATAAGGAAGACACC 0: 1
1: 0
2: 0
3: 10
4: 114
Right 975085705 4:70336158-70336180 AGACACCTCCACAACTGAAACGG 0: 1
1: 0
2: 1
3: 17
4: 171
975085703_975085705 -8 Left 975085703 4:70336143-70336165 CCCAGACTATAAGGAAGACACCT 0: 1
1: 0
2: 0
3: 16
4: 166
Right 975085705 4:70336158-70336180 AGACACCTCCACAACTGAAACGG 0: 1
1: 0
2: 1
3: 17
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975085705 Original CRISPR AGACACCTCCACAACTGAAA CGG Exonic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
902328138 1:15716201-15716223 AAACACCTCCAAATCAGAAATGG - Intronic
908306270 1:62821512-62821534 AAACACGTCCACCAATGAAATGG - Intronic
908311081 1:62884900-62884922 AGCCATATCCACAACTGCAAAGG - Intergenic
909282907 1:73779015-73779037 AGACACTTACACTATTGAAAGGG + Intergenic
909715528 1:78702346-78702368 AGACCCCTGCACAACTAAAGAGG + Intergenic
910532331 1:88251735-88251757 AAAGACATACACAACTGAAAAGG - Intergenic
910754690 1:90675229-90675251 AGAAATCTAAACAACTGAAAGGG + Intergenic
911114815 1:94236716-94236738 AAACACGTCCACAATTGAACTGG + Intronic
911981673 1:104576879-104576901 ACCCATCTCCACAACTAAAAAGG - Intergenic
912663888 1:111561687-111561709 AGACACTTCCATAAATGAGAAGG - Intronic
917224345 1:172765584-172765606 AGACACCTCCATTTCTGAAGTGG + Intergenic
917523043 1:175763716-175763738 AGCCACCTGCACAATTGAAAGGG + Intergenic
918097330 1:181346064-181346086 AGACCCCTGCACAGCTGAAGGGG + Intergenic
923472402 1:234303684-234303706 AGACACCACCACAACCAAAATGG - Intronic
1064253281 10:13723308-13723330 AGATACCACTACAAATGAAAAGG - Intronic
1065354151 10:24822785-24822807 AAACACCCACACAACAGAAATGG + Intergenic
1068059245 10:52046310-52046332 AAATACCTCCACAAATGTAAAGG - Intronic
1068299474 10:55120141-55120163 ATTCACCTCCACAACTGGAGTGG - Intronic
1070845645 10:79520986-79521008 AGACACTTTAACATCTGAAACGG + Intergenic
1071672156 10:87618826-87618848 GGACATCTCCACCCCTGAAAGGG - Intergenic
1072990008 10:100183988-100184010 AAATACCTCCACACCTAAAAAGG + Intronic
1073508373 10:104023323-104023345 AGACAACTCCAAAACTTAAATGG + Intronic
1076796795 10:132802307-132802329 AGACACCTCCATAAAAGGAAAGG - Intergenic
1079570099 11:21932413-21932435 ACCCACCTCCACAACTGGGAAGG + Intergenic
1080178253 11:29393063-29393085 AGAAACCACCACTACTGCAAAGG - Intergenic
1084339924 11:68490659-68490681 AGAAACTTCCGTAACTGAAAAGG - Intronic
1087638169 11:100726761-100726783 AATCACCTCCACAACTCAGATGG - Intronic
1089010460 11:115127974-115127996 AGACACCTCCACCACTCTAGGGG + Intergenic
1089381447 11:118035634-118035656 AGACTCCTCCACACCTGAGGAGG - Intergenic
1090958259 11:131533439-131533461 AGACGTCTCCATCACTGAAATGG + Intronic
1091555206 12:1567837-1567859 AGAAACCTCCACATGTGAAAAGG + Intronic
1092373721 12:7938157-7938179 TGCCACCTCCAGTACTGAAAGGG - Intergenic
1092536675 12:9395443-9395465 AGACCGCTCCACAACAGATAAGG + Intergenic
1092558000 12:9577878-9577900 AGACCGCTCCACAACAGATAAGG - Intergenic
1094504877 12:31053251-31053273 AGACCGCTCCACAACAGATAAGG + Intergenic
1094513296 12:31110039-31110061 AGACCGCTCCACAACAGATAAGG + Intergenic
1095296246 12:40530781-40530803 AGTCACCTCTATAACTGCAAGGG - Intronic
1095728005 12:45473752-45473774 AGAAATTTTCACAACTGAAAAGG + Intergenic
1102765942 12:115433147-115433169 AGATTCCTTCAAAACTGAAAAGG + Intergenic
1103621033 12:122187470-122187492 AGACACTTCAACATCTGGAATGG - Intronic
1104435512 12:128753161-128753183 AGACACCACCACAGCATAAAAGG + Intergenic
1105624256 13:22098006-22098028 AGACACTTTCGCAACTGTAAAGG - Intergenic
1105752501 13:23434418-23434440 AAACAACTCCAGACCTGAAAAGG + Intergenic
1106819190 13:33444222-33444244 AGCCACCTACACAACAGAAAGGG - Intergenic
1107402372 13:40082072-40082094 AGTCACCTACACAACAGGAATGG - Intergenic
1109916453 13:68991958-68991980 AGACACTTCCTCCAATGAAAGGG - Intergenic
1110498216 13:76194198-76194220 AAACACCAACCCAACTGAAAAGG - Intergenic
1111525680 13:89465661-89465683 AGACACCAGCACGACTGCAAGGG - Intergenic
1112787159 13:102963813-102963835 AGACACCTCCACGACCCCAAGGG - Intergenic
1114854985 14:26427912-26427934 GGCCACTTCCACAACTCAAAGGG - Intergenic
1116630266 14:47321920-47321942 AGTAAGCTCCAGAACTGAAAGGG - Intronic
1120683071 14:87504547-87504569 AGACTCATCCAAAAATGAAATGG - Intergenic
1122505182 14:102227467-102227489 AGACACCTCCCCTACAGCAAGGG + Intronic
1124697374 15:31876031-31876053 AGAAACTTCCCAAACTGAAATGG - Intergenic
1126911741 15:53424353-53424375 AGGCACCTTAACAACTGAATTGG - Intergenic
1128527618 15:68423210-68423232 GGACATCTCCCCTACTGAAAAGG - Intronic
1128576604 15:68780266-68780288 AGACATCTGCACAGCTGGAAGGG + Intronic
1131362922 15:91810117-91810139 AGAAACCTCCAAAACTGAAAAGG + Intergenic
1135011131 16:18880034-18880056 ATACACCACCACAACAGTAATGG + Intronic
1137337895 16:47569598-47569620 AGACACATACATAAATGAAAGGG - Intronic
1138181547 16:54943773-54943795 AGACACCTTCCCAACTAACATGG + Intergenic
1139057888 16:63208391-63208413 AGAAAACTCCAAAACTAAAAAGG + Intergenic
1140864559 16:79048889-79048911 AGTGACCTCCAGAACTGTAAGGG + Intronic
1141322326 16:83023135-83023157 AGACAAAACCACAATTGAAATGG - Intronic
1141504465 16:84465476-84465498 AGACAGCCCCACAGCTCAAAAGG - Intergenic
1145829948 17:27907967-27907989 AGACATCTCCAGAAAAGAAAGGG + Intergenic
1151495748 17:74457213-74457235 TCCCACCTCCACCACTGAAAAGG - Intergenic
1151932629 17:77242157-77242179 AAACACCTCTTCAACAGAAATGG + Intergenic
1152896624 17:82914966-82914988 AGACAGCTAAAAAACTGAAAGGG - Intronic
1156863349 18:41863413-41863435 AGAAACCCCCTCAACTGAAGAGG + Intergenic
1158247291 18:55446310-55446332 AGACACCTCCTAAAATGAAGGGG + Intronic
1158412981 18:57224020-57224042 GGAAACCTGCACAACTGGAAAGG - Intergenic
1160249015 18:77185089-77185111 AGACAAGGCCACAACTGTAATGG - Intergenic
1160423615 18:78766011-78766033 AGACACCCCCACAACCGCGATGG - Intergenic
1161434831 19:4256975-4256997 AGTCACCTCCACCCCTTAAATGG + Intronic
1162863491 19:13525892-13525914 CAACACCTCCAGAAGTGAAAAGG + Intronic
1165803633 19:38567479-38567501 AGACACCTCCTCAACTTAGGAGG - Intronic
927044872 2:19267048-19267070 AGTCATCTCCACAACTAAGATGG + Intergenic
929735443 2:44543314-44543336 AGCCACCAGCACAAATGAAAAGG + Intronic
929971959 2:46587793-46587815 AGACACCACCACAACGGTCAAGG + Intronic
930683314 2:54280720-54280742 AGACAACTCCTCCACTAAAACGG - Intronic
931235476 2:60409210-60409232 AGACATCTCCCACACTGAAAGGG + Intergenic
933048238 2:77566483-77566505 AGCCATCTCCACAACTTAAAAGG + Intronic
936490342 2:112964908-112964930 AGTCACATCCATAAGTGAAATGG - Intergenic
937649659 2:124306095-124306117 TGACAGAACCACAACTGAAATGG + Intronic
939669049 2:144987067-144987089 AGACAAAACCACATCTGAAATGG - Intergenic
940015979 2:149104525-149104547 AGACACCTCACCAAAGGAAATGG - Intronic
940129226 2:150362528-150362550 AGACACCAAGACAAGTGAAATGG - Intergenic
940262625 2:151798105-151798127 ATACACATGCACAAATGAAATGG + Intronic
940691769 2:156927383-156927405 AGACACATCCAAGACTGGAAAGG - Intergenic
941617499 2:167737553-167737575 AGACTCCTCTTCAACTGAAGTGG - Intergenic
943684158 2:190799107-190799129 AGAAGCCTCAACCACTGAAAAGG - Intergenic
944325407 2:198398420-198398442 AGACACTTCCTCAATTGTAAGGG + Intronic
945417553 2:209593407-209593429 ACACAGCTACACAACTGCAAAGG - Intronic
945465362 2:210163441-210163463 AGAAACCTCCAAAACTAAAAAGG + Intronic
946524971 2:220508536-220508558 AGAGACGTCCATAACTGTAAGGG + Intergenic
1169583962 20:7059131-7059153 AGACACAGACACAACTCAAAGGG - Intergenic
1169911730 20:10652645-10652667 AGACACCTGTACAATTCAAATGG + Intronic
1170698176 20:18679141-18679163 AAACACTTTCACAACTCAAAAGG - Intronic
1171191400 20:23162064-23162086 AGGCAGCTCCACAGCAGAAAAGG + Intergenic
1172401712 20:34657305-34657327 AGATACCCCCACAACCAAAAAGG + Intronic
1173208702 20:41015122-41015144 AGAAAGATCCACAAATGAAAGGG + Intergenic
1174556418 20:51398481-51398503 AGACCCCTCCACTCCTGAAGTGG - Intronic
1175346218 20:58278361-58278383 AGACAACTCCACAACAGAACAGG + Intergenic
1175699524 20:61126872-61126894 AGAGACTTCCTCATCTGAAACGG + Intergenic
1176101891 20:63368202-63368224 AGCCACATCCACAACTGCAGGGG - Intronic
1177470854 21:21559665-21559687 AAACACCTACTCCACTGAAAGGG + Intergenic
1177527050 21:22307201-22307223 AGACATATCCACAATTGTAATGG - Intergenic
1178856511 21:36254644-36254666 AGACACATACACATCTCAAAGGG + Intronic
1180719645 22:17897877-17897899 AGGAACCTCCAAAACAGAAAAGG - Intronic
1184190097 22:42888584-42888606 AGACACGTCAACAACTGACACGG + Intronic
950982501 3:17323179-17323201 AGACCAACCCACAACTGAAAAGG + Intronic
952587561 3:34911057-34911079 AGACACAACCACCACTGAACTGG - Intergenic
957735308 3:84195090-84195112 AGAAACTTTCAAAACTGAAAAGG + Intergenic
961121858 3:124379440-124379462 AGAAATATCCACAACTGACAAGG - Intronic
963307516 3:143669565-143669587 AGTCACCTCCAGAACAGAATTGG - Intronic
967855203 3:194112242-194112264 AGAGACATCCACAAGTGGAATGG + Intergenic
970693816 4:18651411-18651433 TGTGACATCCACAACTGAAAGGG + Intergenic
971023173 4:22559295-22559317 AGAAACCTTCTCAACTTAAAGGG - Intergenic
971171283 4:24235799-24235821 AGACTCATCCACAGCTGATAAGG + Intergenic
971782999 4:31062532-31062554 AGGCACCTCTACAACTCAGAAGG - Intronic
974093163 4:57333668-57333690 AGACACCTCTACTACTGAGTGGG - Intergenic
974457347 4:62145407-62145429 AGATATCTGCATAACTGAAAAGG + Intergenic
974787031 4:66631836-66631858 TAACACCTCCAGAATTGAAAAGG + Intergenic
975085705 4:70336158-70336180 AGACACCTCCACAACTGAAACGG + Exonic
975310131 4:72894558-72894580 AGACATCTCAAAAAATGAAATGG + Intergenic
976058460 4:81097727-81097749 AGCCATCTCCATAACTTAAAAGG - Intronic
979359041 4:119740359-119740381 AGACACCTCAACAAGTGAGAGGG - Intergenic
979601045 4:122586789-122586811 AGACAGATCGACAACTGAAAAGG + Intergenic
983671499 4:170243156-170243178 AGACACATCAAAATCTGAAAGGG - Intergenic
987007915 5:13729830-13729852 AGAGACCTAGACAAATGAAATGG - Intronic
987963242 5:24837796-24837818 AGAAAGCTCCACAACTGCCATGG - Intergenic
990576472 5:57128194-57128216 ATACAGCTCCTCAACTGGAAAGG - Intergenic
990599345 5:57341771-57341793 AGAAAGCTCCACACCTGAACTGG + Intergenic
990716062 5:58638245-58638267 AGACACCTCAAAAGATGAAAGGG - Intronic
990716462 5:58642866-58642888 TTACACCACCACTACTGAAATGG - Intronic
991130749 5:63120007-63120029 AGACACAACCACAACATAAATGG - Intergenic
992070384 5:73143161-73143183 ACACACCTTCACAAATCAAAAGG - Intergenic
993195435 5:84737167-84737189 AGACAAATTCACAACTGTAATGG + Intergenic
994315702 5:98330871-98330893 AGATAGCTGCCCAACTGAAAAGG - Intergenic
994379956 5:99058900-99058922 AGTCTCCTCCAACACTGAAAAGG + Intergenic
995685800 5:114771055-114771077 ACAAACCTCCACAACGCAAAAGG - Intergenic
995799145 5:115974552-115974574 AGGCACATCAACAACTAAAAAGG - Intronic
996573012 5:124952881-124952903 ACAAGCCTCCATAACTGAAATGG - Intergenic
1000791117 5:165608345-165608367 AGACACCAGTACAACTGAAATGG - Intergenic
1006547738 6:34793041-34793063 AAAAACCTCCACATCTTAAAGGG - Intronic
1007444212 6:41892988-41893010 AGACACCTTTAGAAATGAAAAGG - Intronic
1008482639 6:52002401-52002423 AGACAGTTTCACATCTGAAAGGG - Intronic
1008778723 6:55074044-55074066 GGAAACCTCCAAAGCTGAAAAGG + Intergenic
1013950832 6:115779848-115779870 TGAAACTTCCAGAACTGAAATGG - Intergenic
1015386781 6:132633680-132633702 TGACATCTACTCAACTGAAAAGG - Intergenic
1016507877 6:144804792-144804814 AGATACATCCACATCTCAAAGGG + Intronic
1016622610 6:146129751-146129773 AGACACTTCTGCAACAGAAAGGG + Intronic
1018428350 6:163703252-163703274 AGACTCTTCCACAGCTGCAAGGG - Intergenic
1019269465 7:138986-139008 AGCCCCCTAAACAACTGAAAGGG - Intergenic
1020285494 7:6676556-6676578 AGGCCTCTCCACAAATGAAATGG + Intergenic
1020739778 7:12000113-12000135 AGAAACCTCCCCAACTCAGACGG + Intergenic
1021335332 7:19394388-19394410 AAACACCAACACAAATGAAACGG + Intergenic
1021866551 7:24963724-24963746 AGACACCTCAAAAGGTGAAATGG - Intronic
1021997922 7:26199566-26199588 AGTCAGCTCTACAACTTAAACGG + Intronic
1022197854 7:28086333-28086355 ATGCACCTCCCCAAATGAAACGG - Intronic
1023553731 7:41398306-41398328 AAAAACCTCCAAAACTGAAAAGG - Intergenic
1027180257 7:75934627-75934649 TGAGGCCTCCACAACTGTAATGG - Intronic
1027949296 7:84793477-84793499 AGCCACCTCCTCAACCTAAATGG - Intergenic
1031520010 7:122752686-122752708 AGACAATACCATAACTGAAAGGG - Intronic
1034692505 7:153025092-153025114 AGACACCTCTTCCACTGCAAGGG - Intergenic
1038955937 8:32468818-32468840 AGACACTTCCAAAACCGAAGTGG - Intronic
1039603171 8:38858844-38858866 ATCCACCTACACAATTGAAATGG - Intergenic
1044293137 8:90496148-90496170 ATACACATGCACAAATGAAATGG - Intergenic
1049044940 8:140142357-140142379 AAGCACCTCCAAAACAGAAAGGG + Intronic
1049693875 8:143974290-143974312 ACACTCCTCCACAACTGTAAAGG + Intronic
1057538913 9:95946188-95946210 AGACAAATCCACAACTATAATGG + Intronic
1059102668 9:111484510-111484532 AGCCACCTCCACACCAGAACTGG - Exonic
1059234822 9:112751948-112751970 AGTCTCCTTCACAGCTGAAATGG - Intronic
1061589916 9:131591583-131591605 TGCCACATCCACAACTGGAATGG - Intronic
1062491117 9:136805367-136805389 AGAGACCTCCACAGCAGAAATGG + Exonic
1187352208 X:18530379-18530401 AGAAACTTCCAAAACTAAAATGG - Intronic
1187937001 X:24345871-24345893 AGATCCCTTCACAACTGATAAGG - Intergenic
1189017144 X:37296058-37296080 AGAAATTTGCACAACTGAAAAGG - Intergenic
1189934011 X:46046047-46046069 AGAAACCTCCCAAACTGAAAAGG + Intergenic
1194459228 X:94146080-94146102 AGAAACTTCCAAAACTGAAATGG - Intergenic
1196175772 X:112637776-112637798 TAACACCTCCAAAACTGAATAGG + Intronic
1197094353 X:122575162-122575184 AGAAATCTGCACAACTAAAAGGG - Intergenic
1197343327 X:125300771-125300793 AGACAGCTCCAAACCAGAAATGG + Intergenic
1197354446 X:125419663-125419685 AGAAACCTCCATATTTGAAAAGG + Intergenic
1197808727 X:130422329-130422351 AGACACCTGCAGCACTGATATGG - Intergenic
1199189374 X:144952117-144952139 AGACATTTCCATAACTAAAAGGG - Intergenic
1199568018 X:149236864-149236886 AAACACTTCCTCAACTGATAAGG + Intergenic
1201508246 Y:14728526-14728548 AAACACATACACTACTGAAATGG + Intronic