ID: 975090395

View in Genome Browser
Species Human (GRCh38)
Location 4:70395184-70395206
Sequence GAAATGTGCTGCCCCTGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975090394_975090395 26 Left 975090394 4:70395135-70395157 CCAGGTGTTAATTAAAATTTCTC No data
Right 975090395 4:70395184-70395206 GAAATGTGCTGCCCCTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975090395 Original CRISPR GAAATGTGCTGCCCCTGCTT TGG Intergenic
No off target data available for this crispr