ID: 975094967

View in Genome Browser
Species Human (GRCh38)
Location 4:70447062-70447084
Sequence GGGTGGGTGGGCAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2105
Summary {0: 1, 1: 1, 2: 16, 3: 241, 4: 1846}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975094955_975094967 16 Left 975094955 4:70447023-70447045 CCAACATGAGATTTTCTTTATGA 0: 1
1: 0
2: 3
3: 49
4: 326
Right 975094967 4:70447062-70447084 GGGTGGGTGGGCAGGGAAGAGGG 0: 1
1: 1
2: 16
3: 241
4: 1846
975094954_975094967 17 Left 975094954 4:70447022-70447044 CCCAACATGAGATTTTCTTTATG 0: 1
1: 0
2: 3
3: 24
4: 369
Right 975094967 4:70447062-70447084 GGGTGGGTGGGCAGGGAAGAGGG 0: 1
1: 1
2: 16
3: 241
4: 1846

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975094967 Original CRISPR GGGTGGGTGGGCAGGGAAGA GGG Intronic
Too many off-targets to display for this crispr