ID: 975095753

View in Genome Browser
Species Human (GRCh38)
Location 4:70454453-70454475
Sequence AGGGAGCATGCAGTGCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975095753_975095755 -7 Left 975095753 4:70454453-70454475 CCCACAGGCACTGCATGCTCCCT 0: 1
1: 0
2: 4
3: 33
4: 263
Right 975095755 4:70454469-70454491 GCTCCCTCCTCCCTCCTGCAAGG 0: 1
1: 1
2: 6
3: 109
4: 1245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975095753 Original CRISPR AGGGAGCATGCAGTGCCTGT GGG (reversed) Intronic
900501757 1:3009307-3009329 AAGGAGCCGGCATTGCCTGTTGG - Intergenic
901238114 1:7678407-7678429 AGGGAGCAGGCAGGACCTGGTGG + Intronic
901793774 1:11668649-11668671 GGGGAGCATCCATGGCCTGTGGG - Exonic
902562721 1:17287805-17287827 AGGAAGCATTCAGTACCTGCTGG - Intergenic
903446718 1:23427027-23427049 CCTGAGCATGCAGTGCCTGCCGG + Intergenic
903479828 1:23645097-23645119 AGGGAGCATGGAGGAGCTGTGGG - Intergenic
906154756 1:43607404-43607426 AGTGAGCATCCATGGCCTGTGGG - Intronic
906797984 1:48712633-48712655 AGGAAGCATCCAGTAGCTGTTGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
910440112 1:87243044-87243066 AGGGAGAAAGCAGTGCCTAACGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910851948 1:91657261-91657283 AGGGAGAATGTAGTGGGTGTTGG - Intergenic
911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG + Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
915025904 1:152829248-152829270 AGGGAGCACGCAGTCCAAGTTGG - Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
915831475 1:159134856-159134878 AGGGAGAATGCCGTGCATGAAGG - Intronic
916614014 1:166421268-166421290 AGGGTGCATGAATTTCCTGTGGG - Intergenic
917595494 1:176525096-176525118 AGGAAGCAAGCTGTGGCTGTAGG + Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918683788 1:187389522-187389544 AAGGAGAATGCAGTGGCTTTGGG + Intergenic
919067665 1:192713886-192713908 AGGGAGAATGCATTGAGTGTGGG + Intergenic
919745189 1:201004372-201004394 AGTGAGCTTGGAGTCCCTGTAGG + Exonic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
922424571 1:225481039-225481061 AGGGAGCCAGCAGGGGCTGTGGG - Intergenic
922549730 1:226485192-226485214 AGGGATCAGGCAGTGGCTGATGG - Intergenic
1066491300 10:35897817-35897839 TTGGGGCATGAAGTGCCTGTCGG + Intergenic
1067662954 10:48250171-48250193 AGGGAGCACGCACTGCAGGTGGG - Intronic
1067708426 10:48628209-48628231 CAGGAGCATGCTGTGCCTGGTGG + Intronic
1068828899 10:61470228-61470250 AGGAAGAATTCAGTGCCAGTTGG + Intergenic
1070414298 10:76175182-76175204 AGCAAGCATGCAGTGCATGGTGG + Intronic
1070493090 10:76995649-76995671 AGGAAGCATTCACTGCCTGGTGG + Intronic
1071482479 10:86075606-86075628 AGGAACCTTGCTGTGCCTGTGGG - Intronic
1073057078 10:100709844-100709866 CTGGAGAATGCAGTGCCTGAGGG - Intergenic
1073515834 10:104074767-104074789 AGGGAGTCTGCTGTGCGTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1076015990 10:127028022-127028044 AAGCAGCATGGAGTGCCTGGTGG + Intronic
1084475557 11:69386747-69386769 AGGCAGCATGGAGTGGCGGTGGG - Intergenic
1089227944 11:116942362-116942384 ATGGAACATGCATTCCCTGTAGG + Intronic
1092045520 12:5429961-5429983 AGGCAGCAAGCAGTGCGTTTAGG - Intergenic
1092085569 12:5756559-5756581 AGTAAGCAGGCAGTGCCTGCGGG + Intronic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1097226094 12:57477580-57477602 AGGGGGCATGCAGGGCCTGGGGG + Exonic
1099004903 12:77224498-77224520 GGGCAGCATGCTGGGCCTGTAGG - Intergenic
1099163561 12:79274720-79274742 AGGGAGCCAGCTGTGGCTGTGGG - Intronic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1106701701 13:32235665-32235687 AGGAAGCAGGTAGTGTCTGTAGG - Intronic
1106906448 13:34414468-34414490 ATGGAGCATGCAGTGGCAGGTGG + Intergenic
1107317948 13:39153828-39153850 AGGCAGCATGAAGTGCATGAAGG - Intergenic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1111757393 13:92415577-92415599 AGTGAGCTTGAAGTGTCTGTGGG + Intronic
1113834287 13:113318744-113318766 AGGGAGAAGGCAGTGAGTGTGGG - Intronic
1118109899 14:62706979-62707001 ATGGAGCAAACACTGCCTGTAGG + Exonic
1118159904 14:63277723-63277745 TGGGAGCATGCAGTGGCAGAGGG + Intronic
1120218235 14:81704006-81704028 AGAGAGCATGGAGAGCCTCTAGG - Intergenic
1121931116 14:97973060-97973082 AGGAAGCACTCAGTGCCTATGGG - Intronic
1122031598 14:98916227-98916249 AGGTGCCATGCAGGGCCTGTGGG + Intergenic
1122205200 14:100144849-100144871 AGGGAGCCGGCACTGCCTGCTGG + Exonic
1122605306 14:102944158-102944180 CGGCAGCGTGCAGTGCCTGGCGG - Exonic
1124139100 15:27061874-27061896 AGAGGGCAGGCAGTGCCTCTCGG - Intronic
1124689357 15:31809014-31809036 AGGGACCAAGAAGTGCCTGGGGG + Intronic
1126452453 15:48823566-48823588 AGGGAGAATGCAGTGCCTTGGGG - Intergenic
1127874038 15:63097328-63097350 GGGGGGTATGCAGTGCCTGATGG + Intergenic
1128402369 15:67296609-67296631 ATGGACCAAGCAGTGCCTGTGGG + Intronic
1129030751 15:72616017-72616039 AGGGAGAATGCAGCAACTGTGGG - Intergenic
1129532041 15:76275189-76275211 AGGGAGCATGCAGAGCATTATGG - Intronic
1129538391 15:76332580-76332602 AGGGGCCCAGCAGTGCCTGTGGG + Intergenic
1129675071 15:77628219-77628241 AGGCAACATGCAGTGTCTCTGGG - Intronic
1129835661 15:78703818-78703840 AGGGAGAATGCAGCAACTGTGGG - Intronic
1130511674 15:84594818-84594840 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1131524039 15:93138641-93138663 AGGAAGCATGTGGGGCCTGTAGG + Intergenic
1131833176 15:96366981-96367003 ACTGAGCATTCCGTGCCTGTAGG + Intergenic
1132469975 16:97111-97133 TGGGAGCAGGTGGTGCCTGTGGG - Intronic
1132845263 16:1998282-1998304 GGGCAGCATGCAGCGCCTGGTGG + Exonic
1134796165 16:17038963-17038985 AAGGAGAATGTAGTGCATGTGGG - Intergenic
1135017646 16:18937130-18937152 AGGGAGCCTGCATTACCTTTAGG - Intergenic
1137709928 16:50559576-50559598 AGGGAGTGGGCAGTGCCTGCTGG + Intronic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1139659152 16:68409128-68409150 TGGGAAAATGCAGTGCCTGCTGG - Intronic
1142552800 17:751501-751523 AGGGAGCATCTAGTTCCTATGGG + Intronic
1142919139 17:3169345-3169367 AGAGAGAATGCAGTGAGTGTGGG + Intergenic
1145043875 17:19596970-19596992 AGGCAGCACGCAGGGCCTGTGGG + Intergenic
1147914571 17:43878827-43878849 AGGGAGCAGGCAGCGCCTGGAGG - Intronic
1147947056 17:44086290-44086312 AGAGAGCCTGCTGTCCCTGTTGG - Intronic
1150234351 17:63580885-63580907 CAGGAGCATGCAATGGCTGTAGG - Intronic
1150336976 17:64337440-64337462 AGGGATAATACAGTGACTGTGGG + Intronic
1151970791 17:77456515-77456537 GGGGAGCCAGTAGTGCCTGTGGG - Intronic
1152029810 17:77834970-77834992 TGGGGGCATGCAGCCCCTGTAGG - Intergenic
1152588103 17:81198040-81198062 ACAGAGCATGCGGTGGCTGTGGG - Intronic
1152692015 17:81722588-81722610 AGGTGGCCTGCAGGGCCTGTGGG - Intergenic
1152750810 17:82061669-82061691 CGGGAACATCCAGTGCCTGCAGG - Exonic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1156072693 18:33231916-33231938 AGGCAGCAGCCAGTGCCTGGAGG - Intronic
1156105949 18:33660871-33660893 AGAGAGCAGACACTGCCTGTGGG + Intronic
1156205094 18:34877154-34877176 TGGGGGCATTCAGTGCATGTGGG + Intronic
1156402581 18:36753216-36753238 TGAGAGCCTGCAGGGCCTGTGGG - Intronic
1157321256 18:46636355-46636377 AGGGAGCCTGCCCTACCTGTAGG - Intronic
1157433743 18:47651626-47651648 AGGGATCAGGAAGTGCCTCTAGG + Intergenic
1161250044 19:3275642-3275664 TGGGAGCGTGCAGGGCCCGTGGG + Intronic
1161393772 19:4034250-4034272 CGGGAGCAGGCCCTGCCTGTGGG + Intronic
1163116573 19:15192283-15192305 AGGGAGCAGTCAGGGCCTGGAGG + Exonic
1163607467 19:18282779-18282801 GGGGTGCATGCAGAGGCTGTAGG - Intergenic
1164465815 19:28486675-28486697 AGGGAGTCTGCAGTGTCTCTCGG - Intergenic
1164553752 19:29233987-29234009 GGGGAGCATGCACTGCCTGCTGG - Intergenic
1168135648 19:54349474-54349496 AGGGAGGATGCAGATCCTGAGGG + Intergenic
1168282619 19:55313495-55313517 AGTGAGCAGGAAGGGCCTGTAGG - Intronic
1168314931 19:55480895-55480917 AGAGAGCAAGCACTGCCTGTAGG - Intronic
925096288 2:1206702-1206724 AGGCTGCATGCAGAGCTTGTAGG - Intronic
925377666 2:3399915-3399937 TGGGAGCACGCAGTGACTGAGGG - Intronic
926449493 2:12984772-12984794 ATGTAGTTTGCAGTGCCTGTGGG - Intergenic
928106641 2:28474735-28474757 AAGCAGCATGCAGTGCCTTTAGG - Intronic
928603997 2:32927361-32927383 AGGCAGCATGAAGGGACTGTTGG + Intergenic
931799152 2:65741655-65741677 AGTGAGCATGCACTGGGTGTGGG + Intergenic
933770502 2:85741226-85741248 ATGGAGTCTGCAGTGGCTGTCGG - Intergenic
935052680 2:99536843-99536865 AGGCACCAGGCAGTGCCTTTGGG + Intergenic
935712176 2:105909028-105909050 TTGGAGCATGCAGTGCTTGAAGG + Intergenic
935755061 2:106270399-106270421 AGGGCGGAGCCAGTGCCTGTGGG + Intergenic
936538824 2:113333652-113333674 AGAGAGCACGCAGTGAGTGTGGG - Intergenic
937334125 2:121050503-121050525 AGGGAGCTGCCAGTGCCCGTGGG - Intergenic
939144423 2:138395703-138395725 AGAGAGACTGCAGTGACTGTGGG + Intergenic
939501851 2:142996625-142996647 AGGGAACAGGCAGTAACTGTGGG + Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941515295 2:166466055-166466077 ATGGAGTATGCAGTTGCTGTGGG - Intronic
942308227 2:174629441-174629463 AGGAAGCATGCTGTCCATGTAGG + Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
944785117 2:203062438-203062460 AGGGATCTTGCAGGGCCTGCAGG + Intronic
945172584 2:207012341-207012363 AGGGGGCAAGGAGAGCCTGTTGG - Intergenic
946096530 2:217279265-217279287 AGTGAGCAAGCAGAGGCTGTAGG + Intergenic
946220431 2:218221250-218221272 AGTAAGCAAGCAGTGCCAGTTGG + Intronic
947587083 2:231363005-231363027 AGAGAGCGTGCAGGGCCTGCTGG + Intronic
948428918 2:237906257-237906279 AGAGAGTGTGCCGTGCCTGTAGG - Intronic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1169712397 20:8579800-8579822 AGGGAGCATGCCGTGCCACAGGG + Intronic
1171237223 20:23536788-23536810 GGGGAGCATGCAGGGCCATTGGG - Intergenic
1173291311 20:41717491-41717513 ACAGATCATGCAGAGCCTGTAGG + Intergenic
1173998535 20:47357864-47357886 AGGGCACAGGCAGTGCCTCTCGG + Intergenic
1175259186 20:57664075-57664097 GTGGACCATGCAGTGCCTGCTGG + Intronic
1175454009 20:59096092-59096114 GGAGAGCAGGCAGTGACTGTGGG - Intergenic
1175571755 20:60028364-60028386 AAGGAGCCTGCAGTCCCAGTGGG - Intronic
1175789463 20:61732414-61732436 AGGGATGGGGCAGTGCCTGTGGG - Intronic
1176092783 20:63326325-63326347 TGGGAGCATGCAGTGCTCCTGGG - Intronic
1176419011 21:6499343-6499365 AGGGAGCACGTAGTGCGCGTGGG + Intergenic
1176940060 21:14912637-14912659 AGGGAGAATGCATTGATTGTGGG - Intergenic
1178496110 21:33087670-33087692 AGGCAGCCTCAAGTGCCTGTGGG + Intergenic
1179048539 21:37868987-37869009 ATGGAGCACCCATTGCCTGTTGG + Intronic
1179694504 21:43107665-43107687 AGGGAGCACGTAGTGCGCGTGGG + Intergenic
1180131564 21:45830124-45830146 TGGGGGCATGCAGTACATGTGGG + Intronic
1181572090 22:23773134-23773156 AGCGAGCTTGCAGTCCCTGGGGG + Intronic
1182554773 22:31123179-31123201 AGGGAGCCTGCAGTGTATGTGGG - Intronic
1185388077 22:50545658-50545680 AGGGTGCAGGCTGTGCCTGACGG - Intergenic
949792988 3:7813779-7813801 GGAGAGAATGCAGTGTCTGTAGG - Intergenic
950103361 3:10372097-10372119 GGGGAGCATGGGGTGCCTGGAGG + Intronic
952814579 3:37436124-37436146 AAGGAGCATGCAGTGCATAGAGG + Intergenic
952862280 3:37823054-37823076 AGGGAGAATACAGAGCCAGTAGG + Exonic
953899494 3:46831706-46831728 AGGGAGATTGCACTGCCTGGGGG - Intronic
954429141 3:50459942-50459964 AGGGTGGAAGCAGTGCCTGTGGG - Intronic
958682691 3:97352489-97352511 AGAGAGAATGCAGTGACTGTGGG + Intronic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
960008751 3:112810138-112810160 AGGGAACATGCAGTTTCTGATGG - Intronic
961362942 3:126379577-126379599 AGGGAGCATCATGTGCCTGGTGG - Intergenic
961569276 3:127786477-127786499 AGGGAGAAGGCAATGACTGTGGG + Intronic
962417497 3:135196442-135196464 TGGGAGCAGGCAGTGCCAGGAGG + Intronic
968315949 3:197725686-197725708 AGGGAATAAGCAGTACCTGTAGG + Intronic
968762679 4:2450709-2450731 AGGGAGGGTGCAGGGCCTGTGGG - Intronic
970824484 4:20254508-20254530 AGGGGTCATGGAGTGCCTGGGGG + Intronic
970912265 4:21291068-21291090 ATGGAACATGCTGTGCCTTTGGG - Intronic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
973199052 4:47479041-47479063 AGAGAACATGCAGTGCCTCGAGG - Intergenic
973934536 4:55829736-55829758 AGGGAGCATCCATTGCCTGATGG - Intergenic
975095753 4:70454453-70454475 AGGGAGCATGCAGTGCCTGTGGG - Intronic
976069353 4:81223413-81223435 AGGGAGCATTCAGTGCCCAGAGG - Intergenic
977090589 4:92670351-92670373 TGGGAGCTTGCAGTGGCTTTGGG + Intronic
978600172 4:110419219-110419241 GGGGAGCTTGCACTGCCTGCAGG - Intronic
980667859 4:135961835-135961857 AGGGAGCATGAAATGTTTGTTGG + Intergenic
980977453 4:139624813-139624835 AGGGAGCATGAAGGCCCTCTTGG + Intergenic
982700691 4:158657513-158657535 GGGCTGCATGCAGTGCTTGTGGG + Intergenic
983216351 4:165006598-165006620 AGGGGCCATGCAGTGCAGGTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
984850601 4:184149353-184149375 AGGAGGCATGCAGTGGCTATTGG - Intronic
985030282 4:185782027-185782049 AGGCAGAATGCAGTACCTGCGGG - Intronic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986250214 5:6048940-6048962 AGGCAGCATGTTGTGCCTGAGGG - Intergenic
986301262 5:6480027-6480049 AAGGAGCATCCAGTGCCAGGGGG + Intronic
986954585 5:13135769-13135791 AGTGAGCATGCAGTGTGTTTAGG - Intergenic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
990448353 5:55913829-55913851 ATGGAGCAGACAGAGCCTGTGGG - Intronic
990604377 5:57394266-57394288 AGAGAGCATGCAGTCTATGTGGG + Intergenic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
992487019 5:77207340-77207362 CAGGATCTTGCAGTGCCTGTGGG + Intergenic
993107114 5:83612054-83612076 AAGGAGACTTCAGTGCCTGTGGG + Intergenic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
994013415 5:94936461-94936483 AGGGAACATACATTGCTTGTTGG + Intronic
994613728 5:102077939-102077961 AGGGAGGATGCAGTGGCGCTAGG - Intergenic
994830604 5:104777503-104777525 AGGGAGCATGTACTGCCTTTAGG - Intergenic
998617303 5:143754176-143754198 AGGGTTCATGGTGTGCCTGTGGG + Intergenic
999432103 5:151533202-151533224 AGGGAGCATCCTGTCCCTGGAGG + Intronic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
1001164453 5:169350900-169350922 GTGGAGCATGCAGTGCCTAATGG - Intergenic
1001845255 5:174916445-174916467 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1003167724 6:3695914-3695936 TGGGAGGATGCAGTGGCTGTGGG + Intergenic
1003425997 6:5998924-5998946 CGGGAGCATGGAGTGAGTGTGGG + Exonic
1006190417 6:32204184-32204206 TGGCAGGCTGCAGTGCCTGTGGG + Exonic
1006630710 6:35427837-35427859 AGGGAGGCTGCAGCGCCCGTAGG - Exonic
1007271539 6:40641145-40641167 GGGAAGCATGCAGGGCCTGCCGG + Intergenic
1007603424 6:43098193-43098215 AGGCAGCAAGCAGTGCCTTAAGG - Intronic
1008192267 6:48474838-48474860 AGGAAGAATGCAGTAACTGTGGG + Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010834913 6:80574039-80574061 TGGGAGCATGAAGTTCCTTTTGG - Intergenic
1011018857 6:82788606-82788628 AGGGAGAGTGCAGAGCTTGTCGG + Intergenic
1011201779 6:84844943-84844965 AGGGAGCATGCCTGGCATGTTGG + Intergenic
1012073796 6:94657774-94657796 AGGGAGAAAGCAGTGACTGATGG - Intergenic
1012924916 6:105258097-105258119 AGGTGGCATGCACTGCCTGACGG + Intergenic
1012953496 6:105543494-105543516 AGGGAGGAGGCACTGCCTTTTGG + Intergenic
1014114204 6:117654225-117654247 AGAGAGCATGCAGTGCATTTTGG + Intergenic
1015227945 6:130880025-130880047 ACGGTGCATGCAGTGCATGGGGG - Intronic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1016880894 6:148911084-148911106 AGGGGGGATGCAGGGCCTCTGGG - Intronic
1017786707 6:157762691-157762713 AGGGAGGATGCAGTGGGGGTTGG + Intronic
1018648310 6:165968829-165968851 AGGCAGAAGGCAGAGCCTGTAGG + Intronic
1019100623 6:169626361-169626383 AGGGGGGTTGCATTGCCTGTGGG + Intronic
1021123629 7:16825635-16825657 AGGGAGAATGCAGTGATTATGGG + Intronic
1021295525 7:18901524-18901546 TGGGAGAATCCAATGCCTGTAGG + Intronic
1023152591 7:37215783-37215805 AGGGGGCATGCCGTGCCACTGGG - Intronic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1024319204 7:48048394-48048416 AGGGCACATGTATTGCCTGTTGG + Intronic
1024705956 7:51959785-51959807 AGGAAGAATGCAGTGACTGGGGG - Intergenic
1026180205 7:68032611-68032633 AGGGGGCTTGCAGTATCTGTGGG - Intergenic
1026353767 7:69539861-69539883 AGGGAGAATGCATTCCATGTAGG - Intergenic
1027504723 7:79001779-79001801 AGGCAGCATGCATTGTCTCTTGG - Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1031412599 7:121457440-121457462 AGGGAGAATGCTGTGACTGTGGG - Intergenic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033647649 7:143317597-143317619 AGGGAGCCTTCAGTTCCTTTAGG + Intronic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1035367935 7:158360902-158360924 AGGGTGGATGCAGGGTCTGTGGG - Intronic
1035368001 7:158361147-158361169 AGGGTGGATGCAGGGTCTGTGGG - Intronic
1035368029 7:158361241-158361263 AGGGTGGATGCAGGGTCTGTGGG - Intronic
1035688651 8:1545271-1545293 AGGGTGCACGCCGTGCTTGTGGG - Intronic
1036044045 8:5119969-5119991 GGGGAGGAAGCAGTGCCCGTGGG - Intergenic
1036420256 8:8588838-8588860 AGTGAGATTGCATTGCCTGTGGG + Intergenic
1036571027 8:9979984-9980006 AGGGAGGAGGCAGTGGCTGGAGG + Intergenic
1037594700 8:20345324-20345346 GGGGAGCATGCAGTGTTTGAGGG + Intergenic
1042771298 8:72385615-72385637 AATGAGCCTGCAGTGCCTGGTGG - Intergenic
1042847751 8:73185388-73185410 AGTGAGCAAGCAGGGGCTGTGGG + Intergenic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1045189180 8:99866306-99866328 AGGGACCATGAAGTGGCTGCTGG + Intronic
1045473133 8:102530398-102530420 AGGGATGATGCAGTGCCTCAGGG + Intronic
1045645496 8:104293291-104293313 AGGAAGGTGGCAGTGCCTGTAGG - Intergenic
1049537169 8:143187836-143187858 ATGGAGGATGCAGGGCCAGTGGG + Intergenic
1049587816 8:143440126-143440148 AGGCAGCTTGCAGAGCCTGTTGG + Exonic
1050242443 9:3651390-3651412 AGGGGGCATGAAGTACATGTTGG - Intergenic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1054701767 9:68419922-68419944 AGGGAGCATTCAAAGCCTGATGG - Intronic
1055977051 9:81965779-81965801 AGGGAGCAAGATGTGACTGTTGG + Intergenic
1056094230 9:83234493-83234515 AGTGAGCCTGAAGTACCTGTGGG - Intergenic
1056338703 9:85602853-85602875 AGAGAACATGCAGTGACTGTGGG + Intronic
1056588390 9:87944321-87944343 GGGCAGCATGCAGCGCCTGGTGG + Intergenic
1056674284 9:88660757-88660779 AATGAGCATCCAGTGCCTGCAGG + Intergenic
1057189095 9:93076245-93076267 AGAGAGCATGCACAGCCTCTTGG - Intronic
1057725472 9:97565116-97565138 AGGCAGCATTCACTGCCAGTGGG - Intronic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1059328380 9:113518650-113518672 AGGGAGCATGCAGTCCCCCAGGG - Intronic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059665855 9:116446031-116446053 GGGGACCAGGCAGTGCCTGGAGG + Intronic
1061681352 9:132243906-132243928 CAGGAGGATGCAGGGCCTGTCGG - Exonic
1062679677 9:137772013-137772035 AGCCACCATGCAGAGCCTGTGGG + Intronic
1185828696 X:3277431-3277453 TGGGGGCATGCAGTGTATGTTGG + Intronic
1187075693 X:15932229-15932251 AGGGAGAATGCAGTACCTGAGGG + Intergenic
1187713419 X:22076990-22077012 AGGAAGAAGCCAGTGCCTGTGGG + Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1189560346 X:42185687-42185709 AGGCAGGATGCAGTTCCTGGGGG + Intergenic
1190685635 X:52870306-52870328 AGGGAGGATTCAGGGTCTGTTGG + Intergenic
1192046107 X:67675597-67675619 AGGAAGATTGCAGTGACTGTGGG - Intronic
1192244868 X:69363684-69363706 AGGGAGCAGACAGTTTCTGTGGG + Intergenic
1192543642 X:71995414-71995436 ATAGAGTATGCAGGGCCTGTGGG - Intergenic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195942185 X:110175678-110175700 AGGGGGCATGCAGGGCTTTTGGG + Exonic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196892323 X:120303166-120303188 AGGGTGCATGCAGTTCCCTTTGG - Intronic
1196928183 X:120654966-120654988 AGTGTTAATGCAGTGCCTGTGGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1201179404 Y:11331812-11331834 ATGAAGAAGGCAGTGCCTGTGGG - Intergenic
1201406419 Y:13654474-13654496 AAAAAGCATGCAGTTCCTGTAGG + Intergenic
1201860330 Y:18590713-18590735 AAGAAGCATGCTGGGCCTGTCGG + Intergenic
1201872993 Y:18729668-18729690 AAGAAGCATGCTGGGCCTGTCGG - Intergenic