ID: 975100405

View in Genome Browser
Species Human (GRCh38)
Location 4:70506713-70506735
Sequence GCACCATGCTTGGCTCCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975100405_975100407 16 Left 975100405 4:70506713-70506735 CCACTAGGAGCCAAGCATGGTGC No data
Right 975100407 4:70506752-70506774 TACAAACTGTCAACTCTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975100405 Original CRISPR GCACCATGCTTGGCTCCTAG TGG (reversed) Intergenic
No off target data available for this crispr