ID: 975102557

View in Genome Browser
Species Human (GRCh38)
Location 4:70531168-70531190
Sequence GCCACCCAGGGAACCCCAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 306}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975102553_975102557 4 Left 975102553 4:70531141-70531163 CCAGCAGGAGGAGCAGGTGTAAA 0: 1
1: 0
2: 1
3: 19
4: 224
Right 975102557 4:70531168-70531190 GCCACCCAGGGAACCCCAGCAGG 0: 1
1: 0
2: 1
3: 24
4: 306
975102547_975102557 28 Left 975102547 4:70531117-70531139 CCAGATGTCCAGGATGGAAGCCT 0: 1
1: 0
2: 2
3: 10
4: 163
Right 975102557 4:70531168-70531190 GCCACCCAGGGAACCCCAGCAGG 0: 1
1: 0
2: 1
3: 24
4: 306
975102552_975102557 8 Left 975102552 4:70531137-70531159 CCTTCCAGCAGGAGGAGCAGGTG 0: 1
1: 0
2: 4
3: 39
4: 430
Right 975102557 4:70531168-70531190 GCCACCCAGGGAACCCCAGCAGG 0: 1
1: 0
2: 1
3: 24
4: 306
975102548_975102557 20 Left 975102548 4:70531125-70531147 CCAGGATGGAAGCCTTCCAGCAG 0: 1
1: 0
2: 1
3: 12
4: 169
Right 975102557 4:70531168-70531190 GCCACCCAGGGAACCCCAGCAGG 0: 1
1: 0
2: 1
3: 24
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975102557 Original CRISPR GCCACCCAGGGAACCCCAGC AGG Exonic
900087448 1:905133-905155 GCGTCCCAGGGAACCCCGGCAGG + Intergenic
900468003 1:2835179-2835201 GCCACGCAGGGATCCGGAGCTGG + Intergenic
900520309 1:3102222-3102244 ACCACCCAGGCCTCCCCAGCGGG + Intronic
900564470 1:3325513-3325535 GCCGCCCAGGGCACCCCTGCTGG - Intronic
900894018 1:5470356-5470378 GCCACCCAGGGCTTCCCAGAGGG - Intergenic
901118936 1:6874494-6874516 CACACCCAGAAAACCCCAGCAGG + Intronic
901456836 1:9367930-9367952 ACCACCCTGGGACCCCCAGGTGG - Exonic
901941945 1:12668955-12668977 TCCACCCAGGGAAGGCCAGATGG - Intergenic
902622171 1:17656852-17656874 ACCACCCATTGAACCCCAGCGGG - Intronic
902719346 1:18293752-18293774 GCCACCCAGCCCACCCCTGCCGG + Intronic
903575580 1:24337730-24337752 GTCACCCTGCGGACCCCAGCAGG + Exonic
904825611 1:33272014-33272036 GCCACCCAGGGAACTGAGGCTGG + Intronic
906387655 1:45385421-45385443 ACCAACCAGGAAACCACAGCAGG + Intronic
906798024 1:48712909-48712931 GCCACCCAGGAAACCCTGGAGGG + Intronic
909238301 1:73180775-73180797 GCCAGTCAGGGGTCCCCAGCGGG - Intergenic
914747076 1:150508826-150508848 ACCACCCAGGGCACTCCTGCAGG + Intronic
915172095 1:153985450-153985472 TCCTCCCAGGGGCCCCCAGCAGG - Intronic
915931483 1:160063137-160063159 CCTGCCCAGGGAACCCCAGCAGG + Intronic
916469291 1:165107614-165107636 CCCACAAAGGGAACCCCATCAGG - Intergenic
917279187 1:173363738-173363760 GCCACCCAGGGAGCCTCCACAGG + Intergenic
917477524 1:175381605-175381627 GCCACCAAGGGCACCCCTGTAGG + Intronic
918042649 1:180922466-180922488 ACCCCCCAAGGAATCCCAGCAGG - Intronic
918920570 1:190704259-190704281 GCAAGCCAGGAAACCCCATCTGG + Intergenic
920133808 1:203753568-203753590 GCCAAACAGAGAACCCCAGAAGG + Intergenic
920176037 1:204102531-204102553 ACCACCCTGGAAGCCCCAGCAGG - Intronic
922567586 1:226610980-226611002 GCCTCCCAGGGTCCCCCACCTGG - Intergenic
922596193 1:226815233-226815255 GCCAGCCAGGAGATCCCAGCAGG - Intergenic
922711636 1:227838340-227838362 GCCACACATGGAATCACAGCAGG - Intronic
922803867 1:228375905-228375927 GCCACCCATGGGAACACAGCAGG - Intronic
923764165 1:236877379-236877401 GGCACCCTAGGAACCTCAGCAGG + Intronic
924771745 1:247085777-247085799 GCCACACAGGTGACCCCTGCAGG + Intergenic
1064359990 10:14655784-14655806 GGCTCCCAGGGATCCCCAGGAGG - Intronic
1067203628 10:44195556-44195578 GCAACCCTGGGCACCCCAGTGGG - Intergenic
1067532840 10:47086850-47086872 ACCACCCCGGGAGCCCCAACAGG - Intergenic
1069909247 10:71749729-71749751 TACAGCCAGGGAACCCCACCTGG - Exonic
1070819363 10:79346002-79346024 GGCACCCAGTGAAGCCCAGGTGG - Intergenic
1073042253 10:100615624-100615646 TCCCCCCAGGGTGCCCCAGCGGG - Intergenic
1076132667 10:128024723-128024745 GCCAGGCAGGGAGCCCCAGGAGG + Intronic
1076706943 10:132307477-132307499 GACACCGGGGGAACCCCTGCGGG + Intronic
1076902676 10:133347656-133347678 ATCACCCAGGGACCCCCACCCGG + Intronic
1077027687 11:448541-448563 GCCACTCAGCCGACCCCAGCTGG + Intronic
1077241367 11:1512269-1512291 GCCCCCCAGCGAAACACAGCTGG + Intergenic
1077342692 11:2033070-2033092 GCCCATCAGGGAGCCCCAGCAGG + Intergenic
1077402134 11:2364171-2364193 GGGACCCAGGGAAGCCCAGGAGG - Intergenic
1077462051 11:2715582-2715604 GGGTCCCAGGGGACCCCAGCAGG - Intronic
1078679519 11:13462932-13462954 GCCACCCACGGTACCCGAGCAGG + Intronic
1079177618 11:18157671-18157693 GCCAGCCAGGTCACCCCAGCAGG + Intronic
1079430448 11:20384659-20384681 AACTCCCAGGGAACCCCACCTGG - Intergenic
1079581315 11:22067505-22067527 GCCATCCAGAAAACACCAGCAGG - Intergenic
1080311885 11:30904172-30904194 TTCACCCAGGGATCCACAGCTGG - Intronic
1082244130 11:49901481-49901503 GTCACCCAGGGACCCACAGGAGG - Intergenic
1082566133 11:54680565-54680587 GTCACCCAGGGACCCACAGGAGG + Intergenic
1083271741 11:61576299-61576321 CCTTGCCAGGGAACCCCAGCTGG - Intronic
1084399772 11:68936851-68936873 GCAGCCCTGGGACCCCCAGCAGG + Exonic
1084752436 11:71213102-71213124 GCCACCCAGGTAAGTCCAGGGGG + Intronic
1084769174 11:71331650-71331672 CCTATCCAGGGAACACCAGCAGG - Intergenic
1084782415 11:71418924-71418946 CCCACCCAGAGAACTGCAGCTGG - Intergenic
1085517878 11:77121963-77121985 GCCACAGAGGGAGCTCCAGCAGG - Exonic
1087159061 11:94931476-94931498 GCCAGCCAAGAAACCCCACCTGG - Intergenic
1087411300 11:97793023-97793045 GCCTGCCAGGGAACCCAAGATGG + Intergenic
1088739297 11:112753698-112753720 GCCACCCCGGGAACCTGAGTTGG + Intergenic
1088797207 11:113274083-113274105 GCCACCCTGGGGCCCCCAGTCGG + Intronic
1089151581 11:116368620-116368642 TTGACTCAGGGAACCCCAGCAGG + Intergenic
1089189528 11:116643987-116644009 CCCACCCAGGGAACTGGAGCTGG + Intergenic
1089214470 11:116827430-116827452 GCCACCAAGAGATCCCCTGCCGG + Intergenic
1089589264 11:119530129-119530151 GCCACCCAGGCAATGCCATCTGG + Intergenic
1090523673 11:127505728-127505750 GCCTCCCAGAGAACCACAGTTGG - Intergenic
1202825678 11_KI270721v1_random:88259-88281 GCCCATCAGGGAGCCCCAGCAGG + Intergenic
1091644208 12:2261550-2261572 GTGTCCCAAGGAACCCCAGCAGG - Intronic
1092025084 12:5233169-5233191 CCCACCCAGGGATGCCCTGCAGG - Intergenic
1093924046 12:24890955-24890977 ACCAAGCAGTGAACCCCAGCTGG - Intronic
1096231320 12:49898343-49898365 GGTCCCCAGGGAGCCCCAGCCGG - Intronic
1099467548 12:83005791-83005813 GCCAAGCAGGGAACCCCAGGAGG + Intronic
1101275542 12:103197292-103197314 CCCACCAAGGGAACCCTATCAGG - Intergenic
1102963679 12:117110638-117110660 GCCAGCCAGGTAACCCCCGGTGG - Intergenic
1104389912 12:128383491-128383513 GACACCCAGGGATTCCCAGTCGG - Intronic
1104640816 12:130465750-130465772 CGCACCCAGGGAATACCAGCGGG + Intronic
1104677422 12:130722019-130722041 CCCACAAAGGGAACCCCATCAGG + Intergenic
1104843773 12:131836761-131836783 CCAGCCCAGGGAACCACAGCAGG - Intronic
1104900351 12:132186707-132186729 GCCGCCCAGGAAATACCAGCCGG + Intergenic
1105642012 13:22275389-22275411 GCCATGCAGGGATCCCCAGTGGG + Intergenic
1107869747 13:44735558-44735580 ACCACCAAGGTAACCACAGCTGG + Intergenic
1107885875 13:44873786-44873808 ACCTCCCCTGGAACCCCAGCAGG + Intergenic
1108465976 13:50715615-50715637 GAGACACAAGGAACCCCAGCAGG + Intronic
1110704617 13:78590431-78590453 GCCATGGAAGGAACCCCAGCTGG - Intergenic
1110705154 13:78596334-78596356 GCCACCCGGAGAACCGCGGCTGG + Intergenic
1112033252 13:95475682-95475704 GCCACCCAGAGAAAGGCAGCTGG - Intronic
1112552079 13:100430788-100430810 GCCACACAGAGAAACCCACCTGG - Intronic
1112840703 13:103573698-103573720 GCAAGCCAGGGACCTCCAGCTGG - Intergenic
1113763972 13:112869395-112869417 TAAACCCAGGGAGCCCCAGCTGG + Intronic
1113882957 13:113638037-113638059 TCCACACAGGGAAAGCCAGCGGG - Intronic
1116901629 14:50367255-50367277 CCAACCCAGGGAAGCCCACCAGG - Intronic
1117084786 14:52188217-52188239 GCAAGCCAGGGACCCCCGGCCGG - Intergenic
1119826184 14:77659016-77659038 GGCACCTGGGGAAGCCCAGCTGG + Intergenic
1121137309 14:91510316-91510338 GCCACCCAGGGAGCAGCTGCAGG + Intronic
1121422347 14:93824596-93824618 TGCTCCCAGGGAGCCCCAGCAGG + Intergenic
1121558127 14:94854004-94854026 GATGCCCAGGTAACCCCAGCTGG + Intergenic
1122045201 14:99017978-99018000 GTCAGCCAGGGTAACCCAGCTGG - Intergenic
1122283666 14:100638681-100638703 GCCAGCCTGGGGACCTCAGCGGG - Intergenic
1122413742 14:101538813-101538835 ATCCCCCAGGGAAGCCCAGCTGG + Intergenic
1122489229 14:102102333-102102355 GCCACCCAGAGAAGCACTGCTGG - Intronic
1122718173 14:103707564-103707586 GCACCCCAGGGCATCCCAGCTGG - Intronic
1122857277 14:104565903-104565925 GCCAGCCAGGGAACCCACGTGGG - Intronic
1122984473 14:105205851-105205873 GCCACACAGGGAGCAGCAGCTGG + Intergenic
1123007266 14:105329960-105329982 CCCTCCCAGGGCATCCCAGCTGG - Intronic
1123110790 14:105866036-105866058 ACCAACCAGGCAACCCCCGCCGG - Intergenic
1123119261 14:105909297-105909319 GCCCCAGGGGGAACCCCAGCAGG - Intergenic
1123778503 15:23603360-23603382 ACCTCCCCTGGAACCCCAGCAGG + Intronic
1124619562 15:31266035-31266057 GCTACCCAGGGAGTCCCTGCAGG - Intergenic
1125603582 15:40928192-40928214 GCCACCCAGGGGACCCTCTCGGG + Intergenic
1128370742 15:67037256-67037278 GGCACCATGGGAACCCCGGCTGG - Intergenic
1129924993 15:79355825-79355847 GCCACCCAGGAAACCACAAATGG - Intronic
1130344822 15:83033181-83033203 TCCAGCCAGGGAAACACAGCAGG + Intronic
1131047208 15:89323780-89323802 CCCACCTAGAGAACCCAAGCCGG + Intronic
1131250655 15:90828089-90828111 GACACCCAGGGCGCCCCAGCAGG + Intergenic
1132176195 15:99717284-99717306 GGCACCCAGGGGAGCCAAGCAGG - Intronic
1132599902 16:768761-768783 GCCAGGCGGGGATCCCCAGCAGG - Exonic
1132973175 16:2698772-2698794 GGCACCAAGGGAGCTCCAGCAGG - Intronic
1133866419 16:9648036-9648058 CCCAGCCAGGGATCCCCACCTGG - Intergenic
1134356173 16:13484132-13484154 GCCAAGCAGGGAATACCAGCTGG - Intergenic
1134593410 16:15475736-15475758 CCCACCCATGCTACCCCAGCAGG + Intronic
1137001740 16:35235237-35235259 GTGCCCCAGGGAACCCCAGGTGG + Intergenic
1137675284 16:50301008-50301030 TCCACCCAGGGATGCACAGCAGG - Intronic
1138275924 16:55734752-55734774 TCAACACAGGGAAGCCCAGCAGG + Intergenic
1138521330 16:57572891-57572913 GCCACAAAGTGAACCTCAGCAGG + Intronic
1138776652 16:59731091-59731113 CCTACAAAGGGAACCCCAGCAGG + Intronic
1139586734 16:67908782-67908804 GCCACCCAAGGATGTCCAGCTGG + Exonic
1139590503 16:67930412-67930434 GCCACTGAGGCGACCCCAGCCGG + Exonic
1139952997 16:70680936-70680958 GTGGCCCAGGGCACCCCAGCAGG - Intronic
1140870860 16:79105106-79105128 CCCACCCAAAGACCCCCAGCAGG - Intronic
1141329208 16:83093357-83093379 GCCACTCACGGCACTCCAGCCGG - Intronic
1143183981 17:4999779-4999801 TCCAACCTGGGAACCCCAGACGG + Intronic
1143450100 17:7031226-7031248 GAAACCCAGTGAAACCCAGCAGG + Intergenic
1145974795 17:28977805-28977827 TCCACCCAGTGAGCCACAGCCGG + Intronic
1148141738 17:45333884-45333906 GGGAGCCAGGGAACACCAGCAGG + Intergenic
1148384050 17:47221846-47221868 GCCACCCTGGGTATGCCAGCTGG + Exonic
1151301874 17:73232657-73232679 GCCCCCCAGGGAAGCCCCCCAGG - Exonic
1151838108 17:76597449-76597471 GCCACCCAGTGACCTCCAGCTGG + Intergenic
1152317718 17:79590596-79590618 GCCTCCCAGGACATCCCAGCTGG + Intergenic
1152390949 17:80003329-80003351 GCCACCCCGGGAACGCATGCCGG + Intronic
1154355749 18:13622199-13622221 GCCACCCCAGGAAACCCACCTGG - Intronic
1157711518 18:49852970-49852992 GTCACCAAAGGAGCCCCAGCAGG - Intronic
1159562385 18:70009027-70009049 CCCACCAAGGGAAGCCCATCAGG + Intronic
1160497583 18:79384232-79384254 GGCACCCTGGGGACCCCAGCGGG + Intergenic
1160551701 18:79697503-79697525 GCCACCCAGCGTCTCCCAGCCGG + Intronic
1160868710 19:1267379-1267401 GCCACCCTGGGAACCCAGGATGG + Intronic
1161577745 19:5064189-5064211 GCCACCCACGCAAGCCCAGGAGG - Intronic
1162350742 19:10147706-10147728 GGCAACCAGGGAAACCCAGGAGG - Intronic
1162775099 19:12974784-12974806 CACTCCCAGGGAACCCCAGTTGG - Intergenic
1163153210 19:15427014-15427036 GCCCCCCAGGGACCCTCAGATGG + Exonic
1163375564 19:16928121-16928143 TTCACCCATGGAGCCCCAGCCGG + Exonic
1163743821 19:19033281-19033303 GCCACCCAGGCCAACCCGGCGGG + Intronic
1165426212 19:35746789-35746811 GTCCCCAAGGGCACCCCAGCGGG - Exonic
1166048946 19:40246808-40246830 GCCACTCTTGGAGCCCCAGCTGG - Intronic
1166327116 19:42057935-42057957 GCCACCCAGGAAATGCAAGCTGG - Intronic
1166945195 19:46391941-46391963 GCCACCTAGGGAAGCTCACCCGG + Intronic
1167246701 19:48377307-48377329 GCCAGGCAGGAAACCCCAGTGGG + Intergenic
1167282231 19:48576224-48576246 GCCTCCCAGGGATACCCACCCGG + Intronic
1167632095 19:50631712-50631734 GCGACTCAGGGAACCGCAACTGG - Intronic
925911868 2:8578996-8579018 GCCACCCAGGGAACACCCTTTGG + Intergenic
927468180 2:23352152-23352174 GCCAACCATGGAATCCTAGCAGG - Intergenic
927513686 2:23659824-23659846 GCCACCCAGGGAACCCTGAGGGG - Intronic
928941356 2:36730570-36730592 GCAAGCCAGGGAACCCCAGCCGG + Intronic
930651595 2:53970254-53970276 GCTACCCAGGGCCCCCCAGGTGG + Intronic
933557690 2:83851141-83851163 GCCAGCCAGAGGTCCCCAGCTGG - Intergenic
935781057 2:106509645-106509667 GCCACCCAGGGAGCTGGAGCAGG + Intergenic
936081548 2:109435916-109435938 ACCACCCAGGGTCCCCTAGCAGG + Intronic
937236997 2:120437094-120437116 GCCTCTCAGGGAAGCTCAGCTGG + Intergenic
937272313 2:120660912-120660934 GCCCGCCAAGGAACACCAGCTGG - Intergenic
937312190 2:120909245-120909267 GCCAGGCAGGGAACACCAGGTGG - Intronic
940136388 2:150440730-150440752 GGCAACCAGGGAAGCCCAGTTGG + Intergenic
941103237 2:161321874-161321896 ACCAGCCAGGGAACTCCACCTGG + Intronic
946646894 2:221846962-221846984 GCTTCCCAGGGAACCCAAGCTGG + Intergenic
948278785 2:236730606-236730628 GTGACCCAGAGAACTCCAGCCGG - Intergenic
948642709 2:239385667-239385689 GCCACCCCAGGAGCCCCAGAAGG + Intronic
948733313 2:239980890-239980912 GCCAGCAAGGAGACCCCAGCTGG + Intronic
948799780 2:240427288-240427310 GGGACCCAGGGAAACCCAGCAGG + Intergenic
948804350 2:240447045-240447067 GGCACCCAGGGATGCCCAGAAGG + Intronic
948941408 2:241198650-241198672 GGCACTTAGGGAACCCCAGATGG + Intronic
948951245 2:241253269-241253291 GACACCCAGGGCATCCTAGCTGG - Intronic
1168923516 20:1560482-1560504 GTCTCCCAGGGAACCCAACCTGG - Intronic
1169181672 20:3574531-3574553 GCCACCCAGGCAACCCACTCAGG + Intronic
1169493940 20:6095213-6095235 GCCACCTAGGGGACCTCAACAGG - Intronic
1170034628 20:11977118-11977140 GCTGCCCAGGCAACCCCAGCTGG + Intergenic
1170567307 20:17614508-17614530 CCCAGCAAGGGAACCCCAGAAGG + Intronic
1170893067 20:20392111-20392133 CCCACCCAGGGCGCCCCAGCAGG + Intronic
1172015704 20:31871132-31871154 GCCATCCAGGGAAGCTCTGCTGG + Exonic
1172837669 20:37883437-37883459 GACAGCCAGGGCAGCCCAGCTGG + Intergenic
1173058222 20:39636524-39636546 GCAAGCCAGGGACCCCCAGCTGG - Intergenic
1174558961 20:51416394-51416416 GGCACCCTGGGAATCCCAGGTGG - Intronic
1174645196 20:52079649-52079671 GGCCCCCAGGGGACCGCAGCAGG + Intronic
1175176478 20:57115341-57115363 GCCACCCAGGAAACCCAAATGGG + Intergenic
1175341884 20:58237196-58237218 ACCACCCGGGGAAGCCCCGCCGG + Intergenic
1175992730 20:62797430-62797452 TCTGCCCAGGGGACCCCAGCAGG - Intronic
1176063245 20:63181398-63181420 GCCACACAGGGAGCCCTACCTGG - Intergenic
1176130468 20:63494655-63494677 GCCAGTTAGGGAAACCCAGCAGG + Intronic
1176239523 20:64069521-64069543 GCCACCCTGTGAACCACAGCGGG - Intronic
1176307163 21:5129786-5129808 GCCAGCCAGGGAGCATCAGCTGG + Intergenic
1179283143 21:39952068-39952090 GCCCACCAGGAAACCACAGCAGG - Intergenic
1179731826 21:43372524-43372546 GCCCACCAGGGAACCACACCAGG + Intergenic
1179849896 21:44132244-44132266 GCCAGCCAGGGAGCATCAGCTGG - Intergenic
1180097010 21:45560435-45560457 GCCACCGTGGGCACCCTAGCGGG - Intergenic
1181090814 22:20471291-20471313 GCATCTCAGGGAACCCCACCTGG + Intronic
1181100148 22:20533483-20533505 TCCACCCAGGGAGGCCCAGCAGG - Intronic
1181161958 22:20964897-20964919 ACCTCCCAGGGATGCCCAGCTGG - Intergenic
1181527433 22:23498145-23498167 GCGACCCAGGGAACAACCGCAGG + Intergenic
1181583883 22:23842442-23842464 GACATCCAGGGAACAGCAGCTGG + Intergenic
1181647767 22:24243065-24243087 GTCACTCAGGGAGACCCAGCAGG + Intronic
1181815687 22:25434928-25434950 GCCTCCCAGGAAACCCTAACTGG - Intergenic
1181858580 22:25800607-25800629 GTCTCCCAGGGGTCCCCAGCTGG - Intronic
1181973453 22:26711272-26711294 GCCTCCCAGAGGTCCCCAGCAGG - Intergenic
1182283740 22:29232265-29232287 GCCCCCCAGGGAGCCCTGGCCGG + Exonic
1183196620 22:36358088-36358110 CCCACCCTGGGAATCCCATCAGG + Intronic
1183400733 22:37602474-37602496 GTCACCCAGAGAAAACCAGCAGG + Intergenic
1183672891 22:39283439-39283461 GCCAGCCAGGGGACTCCAGAGGG + Intergenic
1183698226 22:39435332-39435354 GCTTCACAGGAAACCCCAGCAGG + Intronic
1185316984 22:50183561-50183583 GCCCTGCAGGGGACCCCAGCCGG + Intergenic
1185322896 22:50210075-50210097 GCCACTCAGCGAAGCACAGCCGG + Intronic
950609427 3:14116389-14116411 GCCTCCCAGGGACCCACACCAGG - Intronic
950664515 3:14487146-14487168 TTCACCCAGGGAGCCCCCGCTGG - Exonic
950707830 3:14793886-14793908 GCCACCCTGGGAGGCCCAGGGGG + Intergenic
951180657 3:19654773-19654795 CCCACACAGAGTACCCCAGCTGG - Intergenic
951890627 3:27564742-27564764 GCTTCCCAGGGAACCCTACCTGG + Intergenic
953069971 3:39509841-39509863 GTTCCCCAGGGACCCCCAGCAGG + Intronic
953533914 3:43762661-43762683 ACCACCCAGGGAAGCCACGCTGG - Intergenic
954541184 3:51393785-51393807 GCCACCCAGGCAACCCCCAGTGG + Exonic
954665309 3:52248373-52248395 GCCGCCGAGGGAACTCCAGTCGG - Exonic
954680702 3:52344429-52344451 CACACCCTGTGAACCCCAGCCGG - Intronic
956081418 3:65560690-65560712 GCCACCAAGTGAAACCCATCTGG + Intronic
958449893 3:94259935-94259957 GCAAGCCAGGGACCTCCAGCTGG - Intergenic
958529585 3:95309498-95309520 GCCACCCACAAAGCCCCAGCGGG - Intergenic
961054915 3:123779588-123779610 GCCACTCAGAAAACTCCAGCAGG - Intronic
961445366 3:126978144-126978166 GCCACCCAGGGTCTCCCAGGTGG + Intergenic
962320868 3:134389301-134389323 GTCTCCCAGGGAACTCCAGCTGG - Intergenic
963066631 3:141269368-141269390 ACCACCCAGAGAACCCCATAAGG - Intronic
965626922 3:170690862-170690884 CCCACCCAGGGAACAGCATCTGG - Intronic
967224850 3:187281568-187281590 ACCACCAAGGCATCCCCAGCAGG + Intronic
967789281 3:193529994-193530016 GCCACCCATGGCACCCCAGTTGG + Intronic
968516720 4:1018634-1018656 GAAACACAGGGAACCCCCGCCGG - Intronic
968597562 4:1493244-1493266 GCCACCCAGGGAACCTTGGCAGG + Intergenic
969213906 4:5708357-5708379 GCCACCCCGGGATCCCCAGGTGG - Exonic
969445991 4:7244991-7245013 GCCACCATGGGAACCCAAGGTGG + Intronic
972177083 4:36420597-36420619 GCCAGCCAGAGATCTCCAGCTGG - Intergenic
975102557 4:70531168-70531190 GCCACCCAGGGAACCCCAGCAGG + Exonic
975947352 4:79723791-79723813 GCCACCCATGAAGCCCCAGAGGG + Intergenic
976155914 4:82144699-82144721 GGCTCCCAGAGATCCCCAGCAGG + Intergenic
979742014 4:124162594-124162616 GCCAACATGTGAACCCCAGCTGG - Intergenic
980121719 4:128734786-128734808 GCCAAGCAGTGAACACCAGCTGG + Intergenic
981274280 4:142879806-142879828 GCCACTCAGGAAACCACGGCAGG + Intergenic
982399855 4:154954378-154954400 GCCAGCCAGGGACCTCCGGCTGG + Intergenic
982488773 4:156001941-156001963 TCGACCCAGGGAAGTCCAGCTGG - Intergenic
985101196 4:186460205-186460227 GCCAGCCGAGGATCCCCAGCAGG + Intronic
985614633 5:912267-912289 GCCAGCCAGGTAAACACAGCCGG - Intronic
986656827 5:10021149-10021171 TCCTCCCAGGGAACCCAAGATGG - Intergenic
992996970 5:82343780-82343802 GTGACCCAGGGAATCCCATCTGG + Intronic
992997269 5:82345825-82345847 GGCAGGCAGGGAACCCCAGCAGG + Intronic
993272287 5:85811459-85811481 GGACCACAGGGAACCCCAGCTGG - Intergenic
997346533 5:133196302-133196324 CCCACCCAGGCAGCCCCAGACGG - Intergenic
998450621 5:142231813-142231835 CCCATCCAGGGCACCACAGCAGG - Intergenic
998559214 5:143155427-143155449 TCAACCAAGGGAAGCCCAGCTGG - Intronic
1002133418 5:177094728-177094750 GCCTCCCAGGGAGCACCAGGTGG - Intronic
1002323292 5:178388507-178388529 GCAGCCCAGGGGATCCCAGCTGG + Intronic
1004099950 6:12599210-12599232 GCTACCCTGGGAACAGCAGCAGG + Intergenic
1007423012 6:41730830-41730852 GCTACCCAGGGAAACCCAAGTGG + Intronic
1008641301 6:53465416-53465438 CCCACCCAGGAGAACCCAGCGGG - Intergenic
1008751129 6:54735633-54735655 CCTACCAAGGGAACCCCATCAGG - Intergenic
1012550534 6:100461146-100461168 GCCACCAAGAGGACTCCAGCGGG + Intronic
1019382637 7:732406-732428 GACAACCAGGGCACCCCTGCAGG - Intronic
1019482135 7:1271844-1271866 GCCCGGCAGGAAACCCCAGCAGG - Intergenic
1019708726 7:2508740-2508762 GCCACCAAGAGGATCCCAGCTGG + Intergenic
1020016110 7:4833117-4833139 GCCACACAGCGAGCCCCAGGTGG + Intronic
1020112117 7:5453129-5453151 ACCACCCAGTGACCCCCAGCAGG - Intronic
1022721867 7:32948708-32948730 GCCAGCTAGGGACCTCCAGCTGG - Intergenic
1023030216 7:36084550-36084572 GCGACGCAGGTAACACCAGCTGG - Exonic
1027151758 7:75738611-75738633 GGACCCCAGGGTACCCCAGCTGG - Intronic
1028367244 7:90048201-90048223 GCCACCTAGGCAATCCCAGTAGG - Intergenic
1030106729 7:105993797-105993819 GCCACCCATGGCAGCCCATCAGG - Intronic
1030950850 7:115789505-115789527 GCCTGGAAGGGAACCCCAGCTGG + Intergenic
1031736002 7:125362475-125362497 ATAACCTAGGGAACCCCAGCTGG - Intergenic
1031846021 7:126806755-126806777 GCCCCCCAGTCAAGCCCAGCAGG + Intronic
1032086815 7:128888812-128888834 GGCACCCCGGGAGCCCCAGCAGG + Intronic
1032310281 7:130780055-130780077 CCTACCAAGGGAACCCCATCAGG - Intergenic
1032325433 7:130924183-130924205 GCCACTGAGGGCTCCCCAGCAGG + Intergenic
1033303507 7:140207527-140207549 TCCACCCAGTGAACTCCACCAGG - Intergenic
1034258340 7:149736835-149736857 GCCAGCCAGAGTCCCCCAGCAGG + Intergenic
1034488249 7:151379725-151379747 GCCATCCAGAGAAACCCAGTGGG - Intronic
1034531912 7:151701112-151701134 GCCCCCCAGGGAAGCCCCACTGG + Intronic
1034545249 7:151784955-151784977 GCCACGCAGCCCACCCCAGCAGG - Intronic
1034773447 7:153802250-153802272 GCCACACAGGGGGCCCCAGGAGG + Intergenic
1034872836 7:154699049-154699071 GCCACCCAGGGAACCTGGGAGGG + Intronic
1035363362 7:158328805-158328827 GCCACCCAGGGATCCCAGGGAGG + Intronic
1035470420 7:159105666-159105688 CTCACACAGGGAGCCCCAGCAGG + Intronic
1035576366 8:709329-709351 GTCACCGAGGGAACCGAAGCAGG + Intronic
1035663888 8:1366033-1366055 GCCATCCCAGGAACCGCAGCCGG + Intergenic
1037116660 8:15236771-15236793 GCCAAGCAGGGGACCCCAGAGGG + Intronic
1037494327 8:19424273-19424295 GCCACCCTGGGAAACACAGATGG - Intronic
1038038656 8:23706363-23706385 GCCTCACAGGGACCCCCAGGAGG + Exonic
1038455901 8:27671857-27671879 CCCAGCCAGGGAAACCCAGTTGG - Exonic
1038494303 8:27990713-27990735 GCCAGCCAGTGTACTCCAGCAGG + Intronic
1038562916 8:28596222-28596244 GCAAGCCGGGGAACCTCAGCCGG + Intergenic
1040290591 8:46122117-46122139 CCCACCCAGGTAAGCCCAGGGGG + Intergenic
1041196703 8:55408454-55408476 GTGGCCCAGGGAACCGCAGCAGG + Intronic
1041609664 8:59830711-59830733 GCCTGCCAGGGAACCCAAGATGG - Intergenic
1041983727 8:63894703-63894725 GAAAGCCAGGGACCCCCAGCTGG + Intergenic
1044594151 8:93942053-93942075 GCAAGCCAGGGACCCCCAGTTGG + Intergenic
1049542112 8:143213380-143213402 GACCTCCAGGGACCCCCAGCAGG + Intergenic
1049580161 8:143407459-143407481 GCCGCCCGGGGACCCCTAGCCGG + Intergenic
1053647345 9:40131173-40131195 GCCCCTCTGGGACCCCCAGCAGG - Intergenic
1053758382 9:41332670-41332692 GCCCCTCTGGGACCCCCAGCAGG + Intergenic
1054537234 9:66244997-66245019 GCCCCTCTGGGACCCCCAGCAGG + Intergenic
1055096993 9:72423886-72423908 TCCACCCAGGGAGCCCATGCCGG - Intergenic
1058401510 9:104625103-104625125 CTCGCCCAGGGAACCCCTGCTGG + Intergenic
1060060251 9:120453494-120453516 GCCACCCAGGCACCCCGTGCAGG + Exonic
1060790574 9:126483011-126483033 GCCTCACAGGAAACCCCTGCTGG + Intronic
1061798390 9:133101492-133101514 GGCACCCAGGCCACCCCCGCCGG + Intronic
1061953866 9:133951476-133951498 ACCCGCCAGGCAACCCCAGCTGG + Intronic
1062133271 9:134911805-134911827 TCCACCCAGTGAACTCCAGTGGG - Intronic
1062227751 9:135463102-135463124 TCCACCCAGGAGACCCCAGAGGG - Intergenic
1062252591 9:135605725-135605747 TCCACCCAGGGAATCCCACGGGG - Intergenic
1062341247 9:136094840-136094862 GAAATCCAGGGAAACCCAGCAGG + Intronic
1062708017 9:137955887-137955909 AGCAGCCAGGGCACCCCAGCTGG - Intronic
1062710528 9:137972825-137972847 GCCGCCCAGGGAGCCTGAGCCGG - Intronic
1186307240 X:8275399-8275421 GCCATCCACAGAACCACAGCAGG - Intergenic
1190487403 X:50941737-50941759 GCCAGCCAGAGATACCCAGCTGG + Intergenic
1191703110 X:64064286-64064308 GTCAGCCAGTGAACACCAGCAGG - Intergenic
1195361336 X:104085888-104085910 GTCACCCACAGAACACCAGCAGG + Intergenic
1196288896 X:113915620-113915642 GCAAGCCAGGGACCCCCAGGTGG - Intergenic
1196764776 X:119233244-119233266 CCCACCCAGATAACCCCTGCTGG - Intergenic
1199673521 X:150165984-150166006 GGCCCCCTTGGAACCCCAGCTGG + Intergenic
1200301802 X:154983933-154983955 TCCCCCCAGGGAACCCAAGAAGG + Intronic
1200316951 X:155144375-155144397 GACACTCAGAGAACCCAAGCAGG + Intronic
1201705278 Y:16929737-16929759 CCCACAAAGGGAACCCCATCAGG + Intergenic