ID: 975102557

View in Genome Browser
Species Human (GRCh38)
Location 4:70531168-70531190
Sequence GCCACCCAGGGAACCCCAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 306}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975102552_975102557 8 Left 975102552 4:70531137-70531159 CCTTCCAGCAGGAGGAGCAGGTG 0: 1
1: 0
2: 4
3: 39
4: 430
Right 975102557 4:70531168-70531190 GCCACCCAGGGAACCCCAGCAGG 0: 1
1: 0
2: 1
3: 24
4: 306
975102553_975102557 4 Left 975102553 4:70531141-70531163 CCAGCAGGAGGAGCAGGTGTAAA 0: 1
1: 0
2: 1
3: 19
4: 224
Right 975102557 4:70531168-70531190 GCCACCCAGGGAACCCCAGCAGG 0: 1
1: 0
2: 1
3: 24
4: 306
975102547_975102557 28 Left 975102547 4:70531117-70531139 CCAGATGTCCAGGATGGAAGCCT 0: 1
1: 0
2: 2
3: 10
4: 163
Right 975102557 4:70531168-70531190 GCCACCCAGGGAACCCCAGCAGG 0: 1
1: 0
2: 1
3: 24
4: 306
975102548_975102557 20 Left 975102548 4:70531125-70531147 CCAGGATGGAAGCCTTCCAGCAG 0: 1
1: 0
2: 1
3: 12
4: 169
Right 975102557 4:70531168-70531190 GCCACCCAGGGAACCCCAGCAGG 0: 1
1: 0
2: 1
3: 24
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975102557 Original CRISPR GCCACCCAGGGAACCCCAGC AGG Exonic