ID: 975104004

View in Genome Browser
Species Human (GRCh38)
Location 4:70548226-70548248
Sequence CTTTAAGAATGTTGGGGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975104004_975104012 13 Left 975104004 4:70548226-70548248 CCAATTCCCCAACATTCTTAAAG No data
Right 975104012 4:70548262-70548284 AGCTGGCAAGATGGCCCAATAGG No data
975104004_975104011 4 Left 975104004 4:70548226-70548248 CCAATTCCCCAACATTCTTAAAG No data
Right 975104011 4:70548253-70548275 TTTGGAGGTAGCTGGCAAGATGG No data
975104004_975104010 -4 Left 975104004 4:70548226-70548248 CCAATTCCCCAACATTCTTAAAG No data
Right 975104010 4:70548245-70548267 AAAGAAATTTTGGAGGTAGCTGG No data
975104004_975104013 24 Left 975104004 4:70548226-70548248 CCAATTCCCCAACATTCTTAAAG No data
Right 975104013 4:70548273-70548295 TGGCCCAATAGGAACAGCTCCGG 0: 25
1: 2390
2: 1361
3: 604
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975104004 Original CRISPR CTTTAAGAATGTTGGGGAAT TGG (reversed) Intergenic
No off target data available for this crispr