ID: 975106622

View in Genome Browser
Species Human (GRCh38)
Location 4:70574534-70574556
Sequence GCCACTGGCCCTGGAATATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975106622_975106628 22 Left 975106622 4:70574534-70574556 CCACATATTCCAGGGCCAGTGGC No data
Right 975106628 4:70574579-70574601 ACATATGTCCCTGTATGTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975106622 Original CRISPR GCCACTGGCCCTGGAATATG TGG (reversed) Intergenic
No off target data available for this crispr