ID: 975106623

View in Genome Browser
Species Human (GRCh38)
Location 4:70574543-70574565
Sequence GCTGGACGTGCCACTGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975106623_975106628 13 Left 975106623 4:70574543-70574565 CCAGGGCCAGTGGCACGTCCAGC No data
Right 975106628 4:70574579-70574601 ACATATGTCCCTGTATGTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975106623 Original CRISPR GCTGGACGTGCCACTGGCCC TGG (reversed) Intergenic
No off target data available for this crispr