ID: 975106624

View in Genome Browser
Species Human (GRCh38)
Location 4:70574549-70574571
Sequence GATAGGGCTGGACGTGCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975106624_975106628 7 Left 975106624 4:70574549-70574571 CCAGTGGCACGTCCAGCCCTATC No data
Right 975106628 4:70574579-70574601 ACATATGTCCCTGTATGTCCCGG No data
975106624_975106633 26 Left 975106624 4:70574549-70574571 CCAGTGGCACGTCCAGCCCTATC No data
Right 975106633 4:70574598-70574620 CCGGTCATGAGCCATGTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975106624 Original CRISPR GATAGGGCTGGACGTGCCAC TGG (reversed) Intergenic
No off target data available for this crispr