ID: 975106625

View in Genome Browser
Species Human (GRCh38)
Location 4:70574561-70574583
Sequence TATGTAGCTCATGATAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975106625_975106635 20 Left 975106625 4:70574561-70574583 CCAGCCCTATCATGAGCTACATA No data
Right 975106635 4:70574604-70574626 ATGAGCCATGTGTTAGGTTTGGG No data
975106625_975106634 19 Left 975106625 4:70574561-70574583 CCAGCCCTATCATGAGCTACATA No data
Right 975106634 4:70574603-70574625 CATGAGCCATGTGTTAGGTTTGG No data
975106625_975106636 21 Left 975106625 4:70574561-70574583 CCAGCCCTATCATGAGCTACATA No data
Right 975106636 4:70574605-70574627 TGAGCCATGTGTTAGGTTTGGGG No data
975106625_975106628 -5 Left 975106625 4:70574561-70574583 CCAGCCCTATCATGAGCTACATA No data
Right 975106628 4:70574579-70574601 ACATATGTCCCTGTATGTCCCGG No data
975106625_975106633 14 Left 975106625 4:70574561-70574583 CCAGCCCTATCATGAGCTACATA No data
Right 975106633 4:70574598-70574620 CCGGTCATGAGCCATGTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975106625 Original CRISPR TATGTAGCTCATGATAGGGC TGG (reversed) Intergenic
No off target data available for this crispr